Incidental Mutation 'R4478:Il6ra'
ID331346
Institutional Source Beutler Lab
Gene Symbol Il6ra
Ensembl Gene ENSMUSG00000027947
Gene Nameinterleukin 6 receptor, alpha
SynonymsIL-6R, IL-6 receptor alpha chain, Il6r, CD126
MMRRC Submission 041735-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4478 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89864059-89913196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89890290 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 90 (Y90F)
Ref Sequence ENSEMBL: ENSMUSP00000143541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029559] [ENSMUST00000197679]
Predicted Effect probably damaging
Transcript: ENSMUST00000029559
AA Change: Y90F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029559
Gene: ENSMUSG00000027947
AA Change: Y90F

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
IGc2 38 99 1.35e-9 SMART
Pfam:IL6Ra-bind 109 210 2.9e-21 PFAM
FN3 213 298 2.18e-2 SMART
transmembrane domain 363 385 N/A INTRINSIC
low complexity region 396 417 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197679
AA Change: Y90F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143541
Gene: ENSMUSG00000027947
AA Change: Y90F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 38 99 5.7e-12 SMART
Pfam:IL6Ra-bind 109 210 6.8e-19 PFAM
FN3 213 298 1.1e-4 SMART
transmembrane domain 362 384 N/A INTRINSIC
low complexity region 395 416 N/A INTRINSIC
Meta Mutation Damage Score 0.8465 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 94% (46/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the interleukin 6 (IL6) receptor complex. Interleukin 6 is a potent pleiotropic cytokine that regulates cell growth and differentiation and plays an important role in the immune response. The IL6 receptor is a protein complex consisting of this protein and interleukin 6 signal transducer (IL6ST/GP130/IL6-beta), a receptor subunit also shared by many other cytokines. Dysregulated production of IL6 and this receptor are implicated in the pathogenesis of many diseases, such as multiple myeloma, autoimmune diseases and prostate cancer. Alternatively spliced transcript variants encoding distinct isoforms have been reported. A pseudogene of this gene is found on chromosome 9.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit defective T helper 17 cells development. Mice homozygous for a different knock-out allele exhibit abnormaly inflammatory response and abnormal wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A T 7: 139,975,860 probably null Het
Adam3 T C 8: 24,695,155 D509G probably benign Het
Ank1 C T 8: 23,120,578 T1379I probably benign Het
Ap1m2 A G 9: 21,298,213 V389A probably benign Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
Chd9 T C 8: 91,034,031 probably benign Het
Chp2 A G 7: 122,220,918 D97G probably benign Het
Cpne5 T C 17: 29,209,476 T118A probably damaging Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dag1 G C 9: 108,208,730 T404R probably damaging Het
Dnah3 T G 7: 120,071,863 H599P probably benign Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fabp9 T C 3: 10,197,106 Y30C probably damaging Het
Fnbp1 G A 2: 31,105,254 A56V probably damaging Het
Gm20498 T C 12: 81,489,216 probably benign Het
Hid1 G A 11: 115,361,655 A67V probably damaging Het
Kcnk18 T C 19: 59,235,244 S274P probably damaging Het
Kndc1 A T 7: 139,920,684 D655V probably damaging Het
Lrrk2 G A 15: 91,723,188 A585T probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Myo9b A T 8: 71,291,081 K262M probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1100 G T 2: 86,978,218 R193S probably benign Het
Olfr433 C T 1: 174,042,616 T222I probably benign Het
Olfr779 C T 10: 129,311,776 L90F possibly damaging Het
Plxna4 A T 6: 32,196,133 C1288S possibly damaging Het
Ptpn22 T C 3: 103,902,064 probably benign Het
Rab11fip3 C T 17: 26,016,083 E619K probably damaging Het
Robo2 C A 16: 74,015,873 R311L probably damaging Het
Sdad1 A G 5: 92,297,160 M315T probably damaging Het
Slc39a12 T A 2: 14,420,179 L407* probably null Het
Snap29 T C 16: 17,428,155 V213A probably benign Het
Stard7 T A 2: 127,284,259 L77Q probably damaging Het
Stat5b A G 11: 100,787,284 Y668H probably benign Het
Tgfb2 A G 1: 186,632,499 I266T probably damaging Het
Tmem87a C T 2: 120,369,343 W440* probably null Het
Tnr T A 1: 159,884,756 probably null Het
Ubl3 C T 5: 148,511,977 S18N probably benign Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vmn2r9 T C 5: 108,846,277 E502G probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Vwa8 T A 14: 78,868,801 D61E probably benign Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp1 A G 8: 111,670,543 R366G probably damaging Het
Zfp282 A T 6: 47,890,696 R269* probably null Het
Other mutations in Il6ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Il6ra APN 3 89886043 missense probably damaging 0.97
IGL02198:Il6ra APN 3 89890348 missense probably benign 0.07
IGL02363:Il6ra APN 3 89871253 missense probably benign 0.00
IGL03109:Il6ra APN 3 89876858 nonsense probably null
R0105:Il6ra UTSW 3 89876818 missense probably damaging 1.00
R0569:Il6ra UTSW 3 89877842 critical splice donor site probably null
R0926:Il6ra UTSW 3 89887069 missense probably damaging 0.99
R1837:Il6ra UTSW 3 89890272 missense probably benign 0.00
R1838:Il6ra UTSW 3 89890272 missense probably benign 0.00
R3147:Il6ra UTSW 3 89885928 missense probably benign 0.29
R5470:Il6ra UTSW 3 89885995 missense probably benign 0.05
R5572:Il6ra UTSW 3 89871282 missense probably damaging 1.00
R6169:Il6ra UTSW 3 89871291 missense probably benign 0.15
R6300:Il6ra UTSW 3 89887129 missense probably damaging 0.97
R6543:Il6ra UTSW 3 89876863 missense probably damaging 1.00
R7129:Il6ra UTSW 3 89871247 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGCTATTAAATCTGCCAGATGG -3'
(R):5'- TTTTCTTCCCCAGAGGTGGC -3'

Sequencing Primer
(F):5'- GCGGTGTCCCTTTTCCTGAAAC -3'
(R):5'- TTCTTCCCCAGAGGTGGCAAATG -3'
Posted On2015-07-21