Mutagenetix > Incidental Mutation

Incidental Mutation 'R4478:Kndc1'

331357

Institutional Source

Beutler Lab

Gene Symbol

Kndc1

Ensembl Gene

ENSMUSG00000066129

Gene Name

kinase non-catalytic C-lobe domain (KIND) containing 1

Synonyms

B830014K08Rik, VKIND, very-kind, 2410012C07Rik

MMRRC Submission

041735-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4478 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

139474612-139521450 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 139500600 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 655 (D655V)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053445]

AlphaFold

Q0KK55

Predicted Effect

probably damaging
Transcript: ENSMUST00000053445
AA Change: D655V

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: D655V

Domain	Start	End	E-Value	Type
KIND	37	217	4.66e-65	SMART
Blast:KIND	381	454	2e-10	BLAST
KIND	456	620	1.22e-50	SMART
low complexity region	658	670	N/A	INTRINSIC
low complexity region	755	771	N/A	INTRINSIC
low complexity region	792	801	N/A	INTRINSIC
low complexity region	949	965	N/A	INTRINSIC
coiled coil region	1121	1151	N/A	INTRINSIC
Pfam:RasGEF_N	1242	1341	2.2e-17	PFAM
Pfam:RasGEF	1464	1672	3.8e-22	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000151421
AA Change: D655V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000116435
Gene: ENSMUSG00000066129
AA Change: D655V

Domain	Start	End	E-Value	Type
KIND	37	217	4.66e-65	SMART
Blast:KIND	381	454	2e-10	BLAST
KIND	456	620	1.22e-50	SMART
low complexity region	658	670	N/A	INTRINSIC
low complexity region	755	771	N/A	INTRINSIC
low complexity region	792	801	N/A	INTRINSIC
low complexity region	949	965	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154782

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156941

Meta Mutation Damage Score

0.1215

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.9%

Validation Efficiency

94% (46/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam3	T	C	8: 25,185,171 (GRCm39)	D509G	probably benign	Het
Ank1	C	T	8: 23,610,594 (GRCm39)	T1379I	probably benign	Het
Ap1m2	A	G	9: 21,209,509 (GRCm39)	V389A	probably benign	Het
Cdh15	A	G	8: 123,591,415 (GRCm39)	H517R	probably benign	Het
Chd9	T	C	8: 91,760,659 (GRCm39)		probably benign	Het
Chp2	A	G	7: 121,820,141 (GRCm39)	D97G	probably benign	Het
Cpne5	T	C	17: 29,428,450 (GRCm39)	T118A	probably damaging	Het
D130040H23Rik	C	A	8: 69,755,155 (GRCm39)	H187N	possibly damaging	Het
Dag1	G	C	9: 108,085,929 (GRCm39)	T404R	probably damaging	Het
Dnah3	T	G	7: 119,671,086 (GRCm39)	H599P	probably benign	Het
Eif4g1	G	T	16: 20,497,593 (GRCm39)		probably benign	Het
Fabp9	T	C	3: 10,262,166 (GRCm39)	Y30C	probably damaging	Het
Fnbp1	G	A	2: 30,995,266 (GRCm39)	A56V	probably damaging	Het
Hid1	G	A	11: 115,252,481 (GRCm39)	A67V	probably damaging	Het
Il6ra	T	A	3: 89,797,597 (GRCm39)	Y90F	probably damaging	Het
Kcnk18	T	C	19: 59,223,676 (GRCm39)	S274P	probably damaging	Het
Lrrk2	G	A	15: 91,607,391 (GRCm39)	A585T	probably damaging	Het
Mrc2	G	A	11: 105,239,257 (GRCm39)		probably null	Het
Myo9b	A	T	8: 71,743,725 (GRCm39)	K262M	probably damaging	Het
Obscn	T	C	11: 59,022,472 (GRCm39)	R758G	possibly damaging	Het
Or10aa1	C	T	1: 173,870,182 (GRCm39)	T222I	probably benign	Het
Or6c6b	C	T	10: 129,147,645 (GRCm39)	L90F	possibly damaging	Het
Or8h10	G	T	2: 86,808,562 (GRCm39)	R193S	probably benign	Het
Plxna4	A	T	6: 32,173,068 (GRCm39)	C1288S	possibly damaging	Het
Ptpn22	T	C	3: 103,809,380 (GRCm39)		probably benign	Het
Rab11fip3	C	T	17: 26,235,057 (GRCm39)	E619K	probably damaging	Het
Robo2	C	A	16: 73,812,761 (GRCm39)	R311L	probably damaging	Het
S2bpcox16	T	C	12: 81,535,990 (GRCm39)		probably benign	Het
Sdad1	A	G	5: 92,445,019 (GRCm39)	M315T	probably damaging	Het
Slc39a12	T	A	2: 14,424,990 (GRCm39)	L407*	probably null	Het
Snap29	T	C	16: 17,246,019 (GRCm39)	V213A	probably benign	Het
Spef1l	A	T	7: 139,555,773 (GRCm39)		probably null	Het
Stard7	T	A	2: 127,126,179 (GRCm39)	L77Q	probably damaging	Het
Stat5b	A	G	11: 100,678,110 (GRCm39)	Y668H	probably benign	Het
Tgfb2	A	G	1: 186,364,696 (GRCm39)	I266T	probably damaging	Het
Tmem87a	C	T	2: 120,199,824 (GRCm39)	W440*	probably null	Het
Tnr	T	A	1: 159,712,326 (GRCm39)		probably null	Het
Ubl3	C	T	5: 148,448,787 (GRCm39)	S18N	probably benign	Het
Vmn2r68	TCC	TC	7: 84,870,758 (GRCm39)		probably null	Het
Vmn2r9	T	C	5: 108,994,143 (GRCm39)	E502G	probably benign	Het
Vps8	A	T	16: 21,363,986 (GRCm39)		probably benign	Het
Vwa8	T	A	14: 79,106,241 (GRCm39)	D61E	probably benign	Het
Wdr73	T	C	7: 80,542,969 (GRCm39)	E213G	probably benign	Het
Zfp1	A	G	8: 112,397,175 (GRCm39)	R366G	probably damaging	Het
Zfp282	A	T	6: 47,867,630 (GRCm39)	R269*	probably null	Het

Other mutations in Kndc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Kndc1	APN	7	139,481,904 (GRCm39)	splice site	probably benign
IGL01061:Kndc1	APN	7	139,502,610 (GRCm39)	missense	probably benign	0.00
IGL01099:Kndc1	APN	7	139,500,700 (GRCm39)	missense	probably damaging	1.00
IGL01522:Kndc1	APN	7	139,493,888 (GRCm39)	splice site	probably benign
IGL01767:Kndc1	APN	7	139,509,959 (GRCm39)	missense	probably damaging	1.00
IGL01884:Kndc1	APN	7	139,494,110 (GRCm39)	missense	probably damaging	1.00
IGL01932:Kndc1	APN	7	139,503,705 (GRCm39)	missense	probably damaging	0.98
IGL02133:Kndc1	APN	7	139,500,683 (GRCm39)	missense	probably benign	0.19
IGL02411:Kndc1	APN	7	139,501,829 (GRCm39)	critical splice donor site	probably null
IGL02472:Kndc1	APN	7	139,490,817 (GRCm39)	missense	probably benign	0.01
IGL02537:Kndc1	APN	7	139,490,326 (GRCm39)	missense	probably benign	0.01
IGL02708:Kndc1	APN	7	139,481,097 (GRCm39)	missense	probably damaging	1.00
IGL03115:Kndc1	APN	7	139,501,425 (GRCm39)	missense	probably benign	0.28
IGL03160:Kndc1	APN	7	139,500,605 (GRCm39)	nonsense	probably null
IGL03138:Kndc1	UTSW	7	139,519,791 (GRCm39)	missense	possibly damaging	0.89
PIT4142001:Kndc1	UTSW	7	139,503,692 (GRCm39)	frame shift	probably null
PIT4696001:Kndc1	UTSW	7	139,512,830 (GRCm39)	missense	probably damaging	1.00
R0349:Kndc1	UTSW	7	139,490,220 (GRCm39)	missense	probably benign	0.00
R0384:Kndc1	UTSW	7	139,490,515 (GRCm39)	missense	possibly damaging	0.85
R0415:Kndc1	UTSW	7	139,510,037 (GRCm39)	missense	probably damaging	1.00
R0421:Kndc1	UTSW	7	139,488,912 (GRCm39)	missense	probably damaging	1.00
R0487:Kndc1	UTSW	7	139,493,939 (GRCm39)	missense	probably null	0.19
R0530:Kndc1	UTSW	7	139,481,153 (GRCm39)	missense	probably damaging	1.00
R0905:Kndc1	UTSW	7	139,503,651 (GRCm39)	missense	possibly damaging	0.94
R1434:Kndc1	UTSW	7	139,502,600 (GRCm39)	missense	probably damaging	1.00
R1608:Kndc1	UTSW	7	139,507,321 (GRCm39)	missense	possibly damaging	0.80
R1644:Kndc1	UTSW	7	139,510,669 (GRCm39)	missense	probably damaging	1.00
R1835:Kndc1	UTSW	7	139,507,624 (GRCm39)	missense	probably damaging	0.99
R2012:Kndc1	UTSW	7	139,501,196 (GRCm39)	missense	possibly damaging	0.90
R2102:Kndc1	UTSW	7	139,510,674 (GRCm39)	missense	probably benign	0.02
R2103:Kndc1	UTSW	7	139,501,150 (GRCm39)	missense	probably benign	0.01
R2128:Kndc1	UTSW	7	139,510,025 (GRCm39)	missense	probably damaging	1.00
R2516:Kndc1	UTSW	7	139,501,738 (GRCm39)	missense	probably damaging	1.00
R3030:Kndc1	UTSW	7	139,481,123 (GRCm39)	missense	probably damaging	1.00
R3617:Kndc1	UTSW	7	139,481,976 (GRCm39)	splice site	probably benign
R3747:Kndc1	UTSW	7	139,507,817 (GRCm39)	critical splice donor site	probably null
R3848:Kndc1	UTSW	7	139,488,893 (GRCm39)	missense	probably damaging	1.00
R4028:Kndc1	UTSW	7	139,509,941 (GRCm39)	missense	probably damaging	0.98
R4043:Kndc1	UTSW	7	139,504,044 (GRCm39)	missense	probably benign	0.06
R4044:Kndc1	UTSW	7	139,504,044 (GRCm39)	missense	probably benign	0.06
R4095:Kndc1	UTSW	7	139,516,938 (GRCm39)	missense	possibly damaging	0.49
R4289:Kndc1	UTSW	7	139,490,798 (GRCm39)	missense	probably benign	0.01
R4514:Kndc1	UTSW	7	139,490,202 (GRCm39)	missense	probably benign	0.00
R4540:Kndc1	UTSW	7	139,501,343 (GRCm39)	nonsense	probably null
R4584:Kndc1	UTSW	7	139,481,159 (GRCm39)	missense	probably damaging	1.00
R4693:Kndc1	UTSW	7	139,501,695 (GRCm39)	missense	probably benign	0.02
R4705:Kndc1	UTSW	7	139,510,036 (GRCm39)	missense	possibly damaging	0.81
R4773:Kndc1	UTSW	7	139,503,946 (GRCm39)	nonsense	probably null
R4859:Kndc1	UTSW	7	139,501,821 (GRCm39)	missense	probably benign	0.03
R5004:Kndc1	UTSW	7	139,512,792 (GRCm39)	nonsense	probably null
R5037:Kndc1	UTSW	7	139,490,371 (GRCm39)	missense	possibly damaging	0.52
R5322:Kndc1	UTSW	7	139,516,722 (GRCm39)	missense	probably damaging	1.00
R5428:Kndc1	UTSW	7	139,488,878 (GRCm39)	missense	probably damaging	0.99
R5503:Kndc1	UTSW	7	139,511,802 (GRCm39)	missense	probably damaging	1.00
R5506:Kndc1	UTSW	7	139,507,804 (GRCm39)	missense	probably damaging	1.00
R5525:Kndc1	UTSW	7	139,504,026 (GRCm39)	missense	probably benign	0.00
R5888:Kndc1	UTSW	7	139,475,133 (GRCm39)	missense	probably benign	0.00
R5942:Kndc1	UTSW	7	139,516,792 (GRCm39)	missense	probably damaging	1.00
R5979:Kndc1	UTSW	7	139,519,740 (GRCm39)	missense	probably benign	0.05
R5990:Kndc1	UTSW	7	139,507,333 (GRCm39)	missense	probably damaging	0.99
R6038:Kndc1	UTSW	7	139,503,691 (GRCm39)	frame shift	probably null
R6076:Kndc1	UTSW	7	139,481,954 (GRCm39)	missense	probably damaging	1.00
R6118:Kndc1	UTSW	7	139,503,717 (GRCm39)	missense	probably damaging	1.00
R6151:Kndc1	UTSW	7	139,501,129 (GRCm39)	missense	probably benign	0.04
R6276:Kndc1	UTSW	7	139,500,979 (GRCm39)	missense	probably benign
R6367:Kndc1	UTSW	7	139,493,422 (GRCm39)	missense	probably damaging	1.00
R6726:Kndc1	UTSW	7	139,502,667 (GRCm39)	critical splice donor site	probably null
R6745:Kndc1	UTSW	7	139,500,892 (GRCm39)	missense	probably benign	0.02
R6886:Kndc1	UTSW	7	139,493,485 (GRCm39)	missense	probably benign	0.01
R6912:Kndc1	UTSW	7	139,490,194 (GRCm39)	missense	probably damaging	0.99
R7070:Kndc1	UTSW	7	139,501,744 (GRCm39)	missense	probably damaging	1.00
R7123:Kndc1	UTSW	7	139,516,749 (GRCm39)	missense	probably damaging	0.99
R7158:Kndc1	UTSW	7	139,511,773 (GRCm39)	missense	possibly damaging	0.48
R7248:Kndc1	UTSW	7	139,500,699 (GRCm39)	missense	probably damaging	1.00
R7437:Kndc1	UTSW	7	139,488,959 (GRCm39)	missense	probably damaging	1.00
R7564:Kndc1	UTSW	7	139,500,612 (GRCm39)	missense	probably benign	0.01
R7570:Kndc1	UTSW	7	139,503,691 (GRCm39)	frame shift	probably null
R7625:Kndc1	UTSW	7	139,517,930 (GRCm39)	missense	possibly damaging	0.90
R7629:Kndc1	UTSW	7	139,475,176 (GRCm39)	missense	probably damaging	1.00
R7726:Kndc1	UTSW	7	139,519,751 (GRCm39)	missense	possibly damaging	0.67
R7840:Kndc1	UTSW	7	139,503,731 (GRCm39)	missense	probably damaging	1.00
R7859:Kndc1	UTSW	7	139,500,880 (GRCm39)	missense	possibly damaging	0.57
R7934:Kndc1	UTSW	7	139,501,402 (GRCm39)	missense	probably benign	0.02
R8011:Kndc1	UTSW	7	139,490,536 (GRCm39)	missense	possibly damaging	0.90
R8062:Kndc1	UTSW	7	139,498,760 (GRCm39)	missense	probably benign	0.01
R8134:Kndc1	UTSW	7	139,481,285 (GRCm39)	splice site	probably null
R8197:Kndc1	UTSW	7	139,493,447 (GRCm39)	missense	probably damaging	1.00
R8350:Kndc1	UTSW	7	139,503,960 (GRCm39)	missense	probably damaging	1.00
R8399:Kndc1	UTSW	7	139,493,434 (GRCm39)	missense	probably damaging	1.00
R8400:Kndc1	UTSW	7	139,493,434 (GRCm39)	missense	probably damaging	1.00
R8447:Kndc1	UTSW	7	139,481,121 (GRCm39)	missense	probably damaging	1.00
R8534:Kndc1	UTSW	7	139,503,669 (GRCm39)	missense	probably benign	0.27
R8735:Kndc1	UTSW	7	139,490,130 (GRCm39)	missense	probably benign	0.00
R8816:Kndc1	UTSW	7	139,517,909 (GRCm39)	missense	probably damaging	1.00
R8883:Kndc1	UTSW	7	139,507,708 (GRCm39)	missense	possibly damaging	0.89
R8899:Kndc1	UTSW	7	139,507,708 (GRCm39)	missense	possibly damaging	0.89
R8961:Kndc1	UTSW	7	139,507,708 (GRCm39)	missense	possibly damaging	0.89
R8961:Kndc1	UTSW	7	139,503,976 (GRCm39)	missense	possibly damaging	0.95
R9002:Kndc1	UTSW	7	139,507,708 (GRCm39)	missense	possibly damaging	0.89
R9010:Kndc1	UTSW	7	139,507,708 (GRCm39)	missense	possibly damaging	0.89
R9065:Kndc1	UTSW	7	139,507,708 (GRCm39)	missense	possibly damaging	0.89
R9066:Kndc1	UTSW	7	139,507,708 (GRCm39)	missense	possibly damaging	0.89
R9223:Kndc1	UTSW	7	139,501,357 (GRCm39)	missense	possibly damaging	0.89
R9230:Kndc1	UTSW	7	139,500,600 (GRCm39)	missense	probably damaging	1.00
R9291:Kndc1	UTSW	7	139,475,140 (GRCm39)	missense	possibly damaging	0.55
R9441:Kndc1	UTSW	7	139,501,392 (GRCm39)	missense	probably damaging	0.99
R9476:Kndc1	UTSW	7	139,510,031 (GRCm39)	missense	probably benign	0.00
R9510:Kndc1	UTSW	7	139,510,031 (GRCm39)	missense	probably benign	0.00
R9518:Kndc1	UTSW	7	139,519,827 (GRCm39)	missense	probably damaging	1.00
R9758:Kndc1	UTSW	7	139,500,620 (GRCm39)	missense	possibly damaging	0.71
Z1177:Kndc1	UTSW	7	139,501,828 (GRCm39)	missense	possibly damaging	0.63
Z1186:Kndc1	UTSW	7	139,490,729 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CGGGCTAAGCTTGATGTAGAACAG -3'
(R):5'- AAGGCAAGCTGGTCTCTGTG -3'

Sequencing Primer
(F):5'- AGCTTGATGTAGAACAGCCTCTG -3'
(R):5'- AACTCAGGAGGGGTCACC -3'

Posted On

2015-07-21