Incidental Mutation 'R4478:D130040H23Rik'
ID331360
Institutional Source Beutler Lab
Gene Symbol D130040H23Rik
Ensembl Gene ENSMUSG00000079038
Gene NameRIKEN cDNA D130040H23 gene
Synonyms
MMRRC Submission 041735-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R4478 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location69271080-69314207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 69302503 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 187 (H187N)
Ref Sequence ENSEMBL: ENSMUSP00000077378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078257] [ENSMUST00000212549]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078257
AA Change: H187N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000077378
Gene: ENSMUSG00000079038
AA Change: H187N

DomainStartEndE-ValueType
internal_repeat_1 2 170 4.27e-17 PROSPERO
internal_repeat_1 199 366 4.27e-17 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212443
Predicted Effect possibly damaging
Transcript: ENSMUST00000212549
AA Change: T204K

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 94% (46/49)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A T 7: 139,975,860 probably null Het
Adam3 T C 8: 24,695,155 D509G probably benign Het
Ank1 C T 8: 23,120,578 T1379I probably benign Het
Ap1m2 A G 9: 21,298,213 V389A probably benign Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
Chd9 T C 8: 91,034,031 probably benign Het
Chp2 A G 7: 122,220,918 D97G probably benign Het
Cpne5 T C 17: 29,209,476 T118A probably damaging Het
Dag1 G C 9: 108,208,730 T404R probably damaging Het
Dnah3 T G 7: 120,071,863 H599P probably benign Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fabp9 T C 3: 10,197,106 Y30C probably damaging Het
Fnbp1 G A 2: 31,105,254 A56V probably damaging Het
Gm20498 T C 12: 81,489,216 probably benign Het
Hid1 G A 11: 115,361,655 A67V probably damaging Het
Il6ra T A 3: 89,890,290 Y90F probably damaging Het
Kcnk18 T C 19: 59,235,244 S274P probably damaging Het
Kndc1 A T 7: 139,920,684 D655V probably damaging Het
Lrrk2 G A 15: 91,723,188 A585T probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Myo9b A T 8: 71,291,081 K262M probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1100 G T 2: 86,978,218 R193S probably benign Het
Olfr433 C T 1: 174,042,616 T222I probably benign Het
Olfr779 C T 10: 129,311,776 L90F possibly damaging Het
Plxna4 A T 6: 32,196,133 C1288S possibly damaging Het
Ptpn22 T C 3: 103,902,064 probably benign Het
Rab11fip3 C T 17: 26,016,083 E619K probably damaging Het
Robo2 C A 16: 74,015,873 R311L probably damaging Het
Sdad1 A G 5: 92,297,160 M315T probably damaging Het
Slc39a12 T A 2: 14,420,179 L407* probably null Het
Snap29 T C 16: 17,428,155 V213A probably benign Het
Stard7 T A 2: 127,284,259 L77Q probably damaging Het
Stat5b A G 11: 100,787,284 Y668H probably benign Het
Tgfb2 A G 1: 186,632,499 I266T probably damaging Het
Tmem87a C T 2: 120,369,343 W440* probably null Het
Tnr T A 1: 159,884,756 probably null Het
Ubl3 C T 5: 148,511,977 S18N probably benign Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vmn2r9 T C 5: 108,846,277 E502G probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Vwa8 T A 14: 78,868,801 D61E probably benign Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp1 A G 8: 111,670,543 R366G probably damaging Het
Zfp282 A T 6: 47,890,696 R269* probably null Het
Other mutations in D130040H23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:D130040H23Rik APN 8 69300770 missense possibly damaging 0.59
R0164:D130040H23Rik UTSW 8 69302543 missense possibly damaging 0.61
R0164:D130040H23Rik UTSW 8 69302543 missense possibly damaging 0.61
R0269:D130040H23Rik UTSW 8 69300794 missense probably benign 0.00
R1534:D130040H23Rik UTSW 8 69302726 missense possibly damaging 0.62
R1565:D130040H23Rik UTSW 8 69303160 makesense probably null
R1648:D130040H23Rik UTSW 8 69302981 missense probably benign 0.04
R1869:D130040H23Rik UTSW 8 69302702 missense probably benign 0.22
R1870:D130040H23Rik UTSW 8 69302702 missense probably benign 0.22
R1871:D130040H23Rik UTSW 8 69302702 missense probably benign 0.22
R2025:D130040H23Rik UTSW 8 69302873 missense probably benign 0.29
R3418:D130040H23Rik UTSW 8 69302927 missense probably benign 0.27
R3810:D130040H23Rik UTSW 8 69302370 missense probably damaging 1.00
R3896:D130040H23Rik UTSW 8 69302958 missense probably damaging 1.00
R4477:D130040H23Rik UTSW 8 69302503 missense possibly damaging 0.95
R4479:D130040H23Rik UTSW 8 69302503 missense possibly damaging 0.95
R4480:D130040H23Rik UTSW 8 69302503 missense possibly damaging 0.95
R6849:D130040H23Rik UTSW 8 69302651 nonsense probably null
R7121:D130040H23Rik UTSW 8 69302279 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTAAAGCCTTTTCACAACAGA -3'
(R):5'- AAGGCTTTACCGCATTCCTT -3'

Sequencing Primer
(F):5'- TTTTCACAACAGAGCCATCTCCAG -3'
(R):5'- GTGATGTGCAAAGGTCTTACCAC -3'
Posted On2015-07-21