Incidental Mutation 'R4478:Stat5b'
ID331370
Institutional Source Beutler Lab
Gene Symbol Stat5b
Ensembl Gene ENSMUSG00000020919
Gene Namesignal transducer and activator of transcription 5B
Synonyms
MMRRC Submission 041735-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4478 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100780731-100850724 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100787284 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 668 (Y668H)
Ref Sequence ENSEMBL: ENSMUSP00000102981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004143] [ENSMUST00000107358]
Predicted Effect probably benign
Transcript: ENSMUST00000004143
AA Change: Y668H

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000004143
Gene: ENSMUSG00000020919
AA Change: Y668H

DomainStartEndE-ValueType
STAT_int 2 126 2.3e-60 SMART
Pfam:STAT_alpha 138 330 1e-57 PFAM
Pfam:STAT_bind 332 583 1.6e-100 PFAM
SH2 587 676 3.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107358
AA Change: Y668H

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102981
Gene: ENSMUSG00000020919
AA Change: Y668H

DomainStartEndE-ValueType
STAT_int 2 126 2.3e-60 SMART
Pfam:STAT_alpha 141 330 7.1e-56 PFAM
Pfam:STAT_bind 332 582 3.3e-105 PFAM
SH2 587 676 3.23e-4 SMART
Meta Mutation Damage Score 0.1308 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 94% (46/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein mediates the signal transduction triggered by various cell ligands, such as IL2, IL4, CSF1, and different growth hormones. It has been shown to be involved in diverse biological processes, such as TCR signaling, apoptosis, adult mammary gland development, and sexual dimorphism of liver gene expression. This gene was found to fuse to retinoic acid receptor-alpha (RARA) gene in a small subset of acute promyelocytic leukemias (APLL). The dysregulation of the signaling pathways mediated by this protein may be the cause of the APLL. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this are reduced in size and mammary glands secrete reduced levels of some milk proteins during lactation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A T 7: 139,975,860 probably null Het
Adam3 T C 8: 24,695,155 D509G probably benign Het
Ank1 C T 8: 23,120,578 T1379I probably benign Het
Ap1m2 A G 9: 21,298,213 V389A probably benign Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
Chd9 T C 8: 91,034,031 probably benign Het
Chp2 A G 7: 122,220,918 D97G probably benign Het
Cpne5 T C 17: 29,209,476 T118A probably damaging Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dag1 G C 9: 108,208,730 T404R probably damaging Het
Dnah3 T G 7: 120,071,863 H599P probably benign Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fabp9 T C 3: 10,197,106 Y30C probably damaging Het
Fnbp1 G A 2: 31,105,254 A56V probably damaging Het
Gm20498 T C 12: 81,489,216 probably benign Het
Hid1 G A 11: 115,361,655 A67V probably damaging Het
Il6ra T A 3: 89,890,290 Y90F probably damaging Het
Kcnk18 T C 19: 59,235,244 S274P probably damaging Het
Kndc1 A T 7: 139,920,684 D655V probably damaging Het
Lrrk2 G A 15: 91,723,188 A585T probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Myo9b A T 8: 71,291,081 K262M probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1100 G T 2: 86,978,218 R193S probably benign Het
Olfr433 C T 1: 174,042,616 T222I probably benign Het
Olfr779 C T 10: 129,311,776 L90F possibly damaging Het
Plxna4 A T 6: 32,196,133 C1288S possibly damaging Het
Ptpn22 T C 3: 103,902,064 probably benign Het
Rab11fip3 C T 17: 26,016,083 E619K probably damaging Het
Robo2 C A 16: 74,015,873 R311L probably damaging Het
Sdad1 A G 5: 92,297,160 M315T probably damaging Het
Slc39a12 T A 2: 14,420,179 L407* probably null Het
Snap29 T C 16: 17,428,155 V213A probably benign Het
Stard7 T A 2: 127,284,259 L77Q probably damaging Het
Tgfb2 A G 1: 186,632,499 I266T probably damaging Het
Tmem87a C T 2: 120,369,343 W440* probably null Het
Tnr T A 1: 159,884,756 probably null Het
Ubl3 C T 5: 148,511,977 S18N probably benign Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vmn2r9 T C 5: 108,846,277 E502G probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Vwa8 T A 14: 78,868,801 D61E probably benign Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp1 A G 8: 111,670,543 R366G probably damaging Het
Zfp282 A T 6: 47,890,696 R269* probably null Het
Other mutations in Stat5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02208:Stat5b APN 11 100804913 missense probably damaging 1.00
IGL02675:Stat5b APN 11 100787374 missense probably benign 0.26
IGL02683:Stat5b APN 11 100804946 missense probably benign 0.11
IGL02725:Stat5b APN 11 100805014 missense possibly damaging 0.91
R0305:Stat5b UTSW 11 100802503 missense probably benign 0.00
R0315:Stat5b UTSW 11 100788460 missense probably benign 0.01
R0452:Stat5b UTSW 11 100798330 missense probably benign 0.00
R1267:Stat5b UTSW 11 100798593 missense probably benign 0.08
R1527:Stat5b UTSW 11 100808394 critical splice donor site probably null
R2059:Stat5b UTSW 11 100787332 missense probably benign 0.12
R2316:Stat5b UTSW 11 100796492 missense probably damaging 1.00
R2990:Stat5b UTSW 11 100808362 intron probably null
R4380:Stat5b UTSW 11 100787349 missense probably damaging 1.00
R4584:Stat5b UTSW 11 100787238 missense probably damaging 1.00
R4806:Stat5b UTSW 11 100790797 missense probably benign
R4931:Stat5b UTSW 11 100784254 nonsense probably null
R5008:Stat5b UTSW 11 100802483 missense probably benign 0.00
R5015:Stat5b UTSW 11 100805005 missense possibly damaging 0.64
R5072:Stat5b UTSW 11 100808535 critical splice acceptor site probably null
R5601:Stat5b UTSW 11 100783175 missense probably damaging 0.99
R5638:Stat5b UTSW 11 100784254 nonsense probably null
R5901:Stat5b UTSW 11 100804907 missense possibly damaging 0.62
R6577:Stat5b UTSW 11 100797700 missense probably benign 0.00
R7882:Stat5b UTSW 11 100783775 missense possibly damaging 0.55
R7965:Stat5b UTSW 11 100783775 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ATTGCCTGAAGTCCAGTGGG -3'
(R):5'- TTCTGGTGGCATGACTTCAG -3'

Sequencing Primer
(F):5'- GAGATTTGAACATCCATGCATATGC -3'
(R):5'- CATGACTTCAGTGTGGGGCTTAAATC -3'
Posted On2015-07-21