Incidental Mutation 'R4478:Hid1'
ID331372
Institutional Source Beutler Lab
Gene Symbol Hid1
Ensembl Gene ENSMUSG00000034586
Gene NameHID1 domain containing
SynonymsC630004H02Rik
MMRRC Submission 041735-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R4478 (G1)
Quality Score221
Status Validated
Chromosome11
Chromosomal Location115347707-115367756 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 115361655 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 67 (A67V)
Ref Sequence ENSEMBL: ENSMUSP00000102152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044152] [ENSMUST00000106542]
Predicted Effect probably damaging
Transcript: ENSMUST00000044152
AA Change: A67V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043789
Gene: ENSMUSG00000034586
AA Change: A67V

DomainStartEndE-ValueType
Pfam:Dymeclin 1 763 3.9e-242 PFAM
Pfam:Hid1 1 784 3.1e-260 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106542
AA Change: A67V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102152
Gene: ENSMUSG00000034586
AA Change: A67V

DomainStartEndE-ValueType
Pfam:Dymeclin 1 764 7.5e-275 PFAM
Pfam:Hid1 1 785 2.3e-261 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123428
SMART Domains Protein: ENSMUSP00000121914
Gene: ENSMUSG00000034586

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
Pfam:Hid1 39 273 5.1e-78 PFAM
Pfam:Dymeclin 41 273 1.7e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152977
Meta Mutation Damage Score 0.6194 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 94% (46/49)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A T 7: 139,975,860 probably null Het
Adam3 T C 8: 24,695,155 D509G probably benign Het
Ank1 C T 8: 23,120,578 T1379I probably benign Het
Ap1m2 A G 9: 21,298,213 V389A probably benign Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
Chd9 T C 8: 91,034,031 probably benign Het
Chp2 A G 7: 122,220,918 D97G probably benign Het
Cpne5 T C 17: 29,209,476 T118A probably damaging Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dag1 G C 9: 108,208,730 T404R probably damaging Het
Dnah3 T G 7: 120,071,863 H599P probably benign Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fabp9 T C 3: 10,197,106 Y30C probably damaging Het
Fnbp1 G A 2: 31,105,254 A56V probably damaging Het
Gm20498 T C 12: 81,489,216 probably benign Het
Il6ra T A 3: 89,890,290 Y90F probably damaging Het
Kcnk18 T C 19: 59,235,244 S274P probably damaging Het
Kndc1 A T 7: 139,920,684 D655V probably damaging Het
Lrrk2 G A 15: 91,723,188 A585T probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Myo9b A T 8: 71,291,081 K262M probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1100 G T 2: 86,978,218 R193S probably benign Het
Olfr433 C T 1: 174,042,616 T222I probably benign Het
Olfr779 C T 10: 129,311,776 L90F possibly damaging Het
Plxna4 A T 6: 32,196,133 C1288S possibly damaging Het
Ptpn22 T C 3: 103,902,064 probably benign Het
Rab11fip3 C T 17: 26,016,083 E619K probably damaging Het
Robo2 C A 16: 74,015,873 R311L probably damaging Het
Sdad1 A G 5: 92,297,160 M315T probably damaging Het
Slc39a12 T A 2: 14,420,179 L407* probably null Het
Snap29 T C 16: 17,428,155 V213A probably benign Het
Stard7 T A 2: 127,284,259 L77Q probably damaging Het
Stat5b A G 11: 100,787,284 Y668H probably benign Het
Tgfb2 A G 1: 186,632,499 I266T probably damaging Het
Tmem87a C T 2: 120,369,343 W440* probably null Het
Tnr T A 1: 159,884,756 probably null Het
Ubl3 C T 5: 148,511,977 S18N probably benign Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vmn2r9 T C 5: 108,846,277 E502G probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Vwa8 T A 14: 78,868,801 D61E probably benign Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp1 A G 8: 111,670,543 R366G probably damaging Het
Zfp282 A T 6: 47,890,696 R269* probably null Het
Other mutations in Hid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Hid1 APN 11 115359069 missense probably benign 0.05
IGL00783:Hid1 APN 11 115348510 missense probably damaging 1.00
IGL00935:Hid1 APN 11 115348498 missense probably damaging 1.00
IGL02081:Hid1 APN 11 115348506 missense possibly damaging 0.94
IGL02383:Hid1 APN 11 115352620 missense probably damaging 1.00
IGL02637:Hid1 APN 11 115350595 missense probably damaging 0.97
IGL03174:Hid1 APN 11 115360389 missense probably damaging 1.00
R0124:Hid1 UTSW 11 115356823 missense probably damaging 1.00
R0533:Hid1 UTSW 11 115348809 missense probably damaging 1.00
R1027:Hid1 UTSW 11 115355425 missense probably damaging 1.00
R1069:Hid1 UTSW 11 115356765 missense probably damaging 1.00
R1171:Hid1 UTSW 11 115352717 missense probably benign
R1583:Hid1 UTSW 11 115356750 missense possibly damaging 0.51
R1689:Hid1 UTSW 11 115360357 missense probably damaging 1.00
R1746:Hid1 UTSW 11 115354638 missense probably damaging 0.98
R1772:Hid1 UTSW 11 115348473 missense probably damaging 0.97
R1773:Hid1 UTSW 11 115348510 missense probably damaging 1.00
R1831:Hid1 UTSW 11 115348903 missense probably damaging 1.00
R2234:Hid1 UTSW 11 115351119 missense probably damaging 1.00
R2235:Hid1 UTSW 11 115351119 missense probably damaging 1.00
R2897:Hid1 UTSW 11 115350530 missense probably benign
R2898:Hid1 UTSW 11 115350530 missense probably benign
R3711:Hid1 UTSW 11 115358775 missense probably damaging 1.00
R4059:Hid1 UTSW 11 115356739 missense probably damaging 1.00
R4394:Hid1 UTSW 11 115367642 utr 5 prime probably benign
R4552:Hid1 UTSW 11 115358679 missense possibly damaging 0.94
R4822:Hid1 UTSW 11 115355299 missense probably damaging 1.00
R5691:Hid1 UTSW 11 115348819 missense probably damaging 1.00
R5980:Hid1 UTSW 11 115350948 missense possibly damaging 0.64
R5981:Hid1 UTSW 11 115350948 missense possibly damaging 0.64
R6363:Hid1 UTSW 11 115352596 missense probably damaging 1.00
R6577:Hid1 UTSW 11 115354636 missense possibly damaging 0.89
R7191:Hid1 UTSW 11 115348469 makesense probably null
R7307:Hid1 UTSW 11 115348482 missense probably damaging 1.00
R7485:Hid1 UTSW 11 115354719 missense probably damaging 1.00
R7836:Hid1 UTSW 11 115358995 missense probably damaging 0.96
R7883:Hid1 UTSW 11 115354609 missense probably damaging 1.00
R7904:Hid1 UTSW 11 115355361 missense probably damaging 1.00
R7919:Hid1 UTSW 11 115358995 missense probably damaging 0.96
R7966:Hid1 UTSW 11 115354609 missense probably damaging 1.00
R7987:Hid1 UTSW 11 115355361 missense probably damaging 1.00
X0025:Hid1 UTSW 11 115348803 nonsense probably null
X0066:Hid1 UTSW 11 115354725 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAAGCTCTGATAAATGGCGGC -3'
(R):5'- CAGGGCTCATCTGTGACTGTTG -3'

Sequencing Primer
(F):5'- CAGGGGCCATGGTTACTTTTTCC -3'
(R):5'- ACTGTTGGGAAAGGTGTAACTC -3'
Posted On2015-07-21