Incidental Mutation 'R4478:Gm20498'
List |< first << previous [record 15 of 46] next >> last >|
ID331373
Institutional Source Beutler Lab
Gene Symbol Gm20498
Ensembl Gene ENSMUSG00000021139
Gene Namepredicted gene 20498
Synonyms
MMRRC Submission 041735-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R4478 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location81358860-81532905 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 81489216 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002757] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166664] [ENSMUST00000166723] [ENSMUST00000168463] [ENSMUST00000169124] [ENSMUST00000171459]
Predicted Effect probably benign
Transcript: ENSMUST00000002757
SMART Domains Protein: ENSMUSP00000002757
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 88 1.8e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110339
SMART Domains Protein: ENSMUSP00000105968
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110340
SMART Domains Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 74 6.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163282
Predicted Effect probably benign
Transcript: ENSMUST00000164386
SMART Domains Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166664
SMART Domains Protein: ENSMUSP00000131728
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166723
SMART Domains Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 73 6.9e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167819
Predicted Effect probably benign
Transcript: ENSMUST00000168463
SMART Domains Protein: ENSMUSP00000127295
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 78 2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168961
Predicted Effect probably benign
Transcript: ENSMUST00000169124
SMART Domains Protein: ENSMUSP00000128281
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 69 3.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171237
Predicted Effect probably benign
Transcript: ENSMUST00000171459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185303
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 94% (46/49)
MGI Phenotype FUNCTION: This locus represents naturally occurring readthrough transcription between the neighboring Synj2bp (synaptojanin 2 binding protein) and Cox16 (cytochrome c oxidase assembly protein 16) genes on chromosome 12. The readthrough transcripts encode fusion proteins that share sequence similarity with each individual gene product. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2015]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A T 7: 139,975,860 probably null Het
Adam3 T C 8: 24,695,155 D509G probably benign Het
Ank1 C T 8: 23,120,578 T1379I probably benign Het
Ap1m2 A G 9: 21,298,213 V389A probably benign Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
Chd9 T C 8: 91,034,031 probably benign Het
Chp2 A G 7: 122,220,918 D97G probably benign Het
Cpne5 T C 17: 29,209,476 T118A probably damaging Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dag1 G C 9: 108,208,730 T404R probably damaging Het
Dnah3 T G 7: 120,071,863 H599P probably benign Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fabp9 T C 3: 10,197,106 Y30C probably damaging Het
Fnbp1 G A 2: 31,105,254 A56V probably damaging Het
Hid1 G A 11: 115,361,655 A67V probably damaging Het
Il6ra T A 3: 89,890,290 Y90F probably damaging Het
Kcnk18 T C 19: 59,235,244 S274P probably damaging Het
Kndc1 A T 7: 139,920,684 D655V probably damaging Het
Lrrk2 G A 15: 91,723,188 A585T probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Myo9b A T 8: 71,291,081 K262M probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1100 G T 2: 86,978,218 R193S probably benign Het
Olfr433 C T 1: 174,042,616 T222I probably benign Het
Olfr779 C T 10: 129,311,776 L90F possibly damaging Het
Plxna4 A T 6: 32,196,133 C1288S possibly damaging Het
Ptpn22 T C 3: 103,902,064 probably benign Het
Rab11fip3 C T 17: 26,016,083 E619K probably damaging Het
Robo2 C A 16: 74,015,873 R311L probably damaging Het
Sdad1 A G 5: 92,297,160 M315T probably damaging Het
Slc39a12 T A 2: 14,420,179 L407* probably null Het
Snap29 T C 16: 17,428,155 V213A probably benign Het
Stard7 T A 2: 127,284,259 L77Q probably damaging Het
Stat5b A G 11: 100,787,284 Y668H probably benign Het
Tgfb2 A G 1: 186,632,499 I266T probably damaging Het
Tmem87a C T 2: 120,369,343 W440* probably null Het
Tnr T A 1: 159,884,756 probably null Het
Ubl3 C T 5: 148,511,977 S18N probably benign Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vmn2r9 T C 5: 108,846,277 E502G probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Vwa8 T A 14: 78,868,801 D61E probably benign Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp1 A G 8: 111,670,543 R366G probably damaging Het
Zfp282 A T 6: 47,890,696 R269* probably null Het
Other mutations in Gm20498
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01714:Gm20498 APN 12 81510890 missense probably damaging 1.00
IGL02562:Gm20498 APN 12 81510842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTACCCCAAGTCATCTTGCTG -3'
(R):5'- TTATCCTATAGCTCACACCCCATAG -3'

Sequencing Primer
(F):5'- CTTCCAGGTCATACTGAAACTGAGG -3'
(R):5'- CCCCATAGAAAACAGGATGGTACTG -3'
Posted On2015-07-21