Incidental Mutation 'R4479:Irs1'
ID331383
Institutional Source Beutler Lab
Gene Symbol Irs1
Ensembl Gene ENSMUSG00000055980
Gene Nameinsulin receptor substrate 1
SynonymsG972R, IRS-1
MMRRC Submission 041736-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.592) question?
Stock #R4479 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location82233101-82291416 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 82287294 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1067 (T1067I)
Ref Sequence ENSEMBL: ENSMUSP00000063795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069799]
Predicted Effect probably damaging
Transcript: ENSMUST00000069799
AA Change: T1067I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063795
Gene: ENSMUSG00000055980
AA Change: T1067I

DomainStartEndE-ValueType
PH 13 117 8.13e-14 SMART
low complexity region 123 143 N/A INTRINSIC
IRS 155 257 1.19e-35 SMART
PTBI 155 257 7.8e-60 SMART
low complexity region 263 276 N/A INTRINSIC
low complexity region 378 399 N/A INTRINSIC
low complexity region 407 419 N/A INTRINSIC
low complexity region 551 568 N/A INTRINSIC
low complexity region 662 689 N/A INTRINSIC
low complexity region 784 794 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
low complexity region 824 837 N/A INTRINSIC
low complexity region 1019 1040 N/A INTRINSIC
low complexity region 1051 1062 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1185 1200 N/A INTRINSIC
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit 50 percent reductions in body weights at birth and at 4 months of age, impaired glucose tolerance, and mild insulin and IGF-1 resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adamts20 C T 15: 94,403,445 R66H probably damaging Het
Anks1b A G 10: 90,049,892 E150G probably damaging Het
Chp2 A G 7: 122,220,918 D97G probably benign Het
Cnbd2 T C 2: 156,333,653 probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dusp15 A G 2: 152,944,182 L135P probably damaging Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Erlin2 G T 8: 27,025,099 V10L probably benign Het
F830104G03Rik A G 3: 56,890,213 S98P unknown Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Ighv1-22 G T 12: 114,746,663 A15E possibly damaging Het
Ints4 T C 7: 97,484,971 S37P probably damaging Het
Lrrc28 C T 7: 67,531,614 probably null Het
Olfr1243 A G 2: 89,528,170 I80T possibly damaging Het
Olfr1420 A G 19: 11,896,558 Y179C probably damaging Het
Olfr206 G A 16: 59,344,867 T278I probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Psma3 T C 12: 70,984,781 probably benign Het
Slc7a11 T C 3: 50,417,963 probably benign Het
Tas2r115 T C 6: 132,737,532 D152G probably damaging Het
Tti1 A T 2: 158,008,395 L308Q possibly damaging Het
Unc93b1 G A 19: 3,935,236 A15T probably benign Het
Usp43 G A 11: 67,856,407 R820C possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp286 C G 11: 62,780,204 G348R probably damaging Het
Zkscan5 T C 5: 145,211,174 probably benign Het
Other mutations in Irs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Irs1 APN 1 82288483 missense probably benign 0.01
IGL00534:Irs1 APN 1 82288471 missense probably benign
IGL01926:Irs1 APN 1 82289959 missense probably damaging 0.98
IGL02130:Irs1 APN 1 82289467 missense probably damaging 1.00
IGL03338:Irs1 APN 1 82288401 missense probably benign 0.05
Hoverboard UTSW 1 82290098 nonsense probably null
runt UTSW 1 82287732 frame shift probably null
runt2 UTSW 1 82286967 nonsense probably null
R0019:Irs1 UTSW 1 82287256 nonsense probably null
R0063:Irs1 UTSW 1 82288859 missense probably damaging 1.00
R0063:Irs1 UTSW 1 82288859 missense probably damaging 1.00
R0318:Irs1 UTSW 1 82288660 missense probably benign 0.01
R1199:Irs1 UTSW 1 82289626 missense probably damaging 1.00
R1363:Irs1 UTSW 1 82287288 missense probably benign 0.02
R1584:Irs1 UTSW 1 82289444 missense probably benign 0.24
R1874:Irs1 UTSW 1 82289853 frame shift probably null
R1903:Irs1 UTSW 1 82289461 missense probably damaging 1.00
R1929:Irs1 UTSW 1 82288459 missense probably benign
R1986:Irs1 UTSW 1 82288765 missense probably damaging 1.00
R2136:Irs1 UTSW 1 82290042 missense probably damaging 1.00
R2179:Irs1 UTSW 1 82290219 missense possibly damaging 0.81
R2271:Irs1 UTSW 1 82288459 missense probably benign
R2760:Irs1 UTSW 1 82288570 missense probably damaging 1.00
R3721:Irs1 UTSW 1 82290085 missense probably benign 0.11
R3821:Irs1 UTSW 1 82290049 missense probably benign
R4306:Irs1 UTSW 1 82287964 missense probably benign 0.11
R4420:Irs1 UTSW 1 82288450 missense possibly damaging 0.94
R4451:Irs1 UTSW 1 82289028 missense probably benign 0.00
R4771:Irs1 UTSW 1 82287975 missense probably benign 0.00
R4782:Irs1 UTSW 1 82287463 missense probably benign 0.00
R4836:Irs1 UTSW 1 82287732 frame shift probably null
R4880:Irs1 UTSW 1 82287732 frame shift probably null
R4881:Irs1 UTSW 1 82287732 frame shift probably null
R5031:Irs1 UTSW 1 82286967 nonsense probably null
R5053:Irs1 UTSW 1 82286922 missense probably benign
R5418:Irs1 UTSW 1 82288770 missense probably damaging 1.00
R5595:Irs1 UTSW 1 82289925 missense probably damaging 1.00
R5698:Irs1 UTSW 1 82288734 missense probably benign 0.01
R6381:Irs1 UTSW 1 82287684 missense possibly damaging 0.66
R6563:Irs1 UTSW 1 82288407 missense probably damaging 0.98
R7002:Irs1 UTSW 1 82288260 missense probably benign 0.13
R7095:Irs1 UTSW 1 82290098 nonsense probably null
R7195:Irs1 UTSW 1 82287456 missense probably benign 0.13
R7216:Irs1 UTSW 1 82289755 missense probably damaging 0.98
R7361:Irs1 UTSW 1 82289114 nonsense probably null
R7490:Irs1 UTSW 1 82287264 missense probably damaging 0.99
R7540:Irs1 UTSW 1 82288002 missense not run
R7706:Irs1 UTSW 1 82287691 missense probably damaging 1.00
R7910:Irs1 UTSW 1 82290081 missense probably benign 0.06
R7912:Irs1 UTSW 1 82289884 missense probably benign
R7991:Irs1 UTSW 1 82290081 missense probably benign 0.06
R7993:Irs1 UTSW 1 82289884 missense probably benign
X0063:Irs1 UTSW 1 82288908 missense probably damaging 1.00
X0065:Irs1 UTSW 1 82289365 missense probably damaging 1.00
Z1177:Irs1 UTSW 1 82288996 missense not run
Z1177:Irs1 UTSW 1 82290394 missense not run
Predicted Primers PCR Primer
(F):5'- TCTCAAAGGATGCAGAGCTGTG -3'
(R):5'- TATGCTGACATGCGGACAGG -3'

Sequencing Primer
(F):5'- CAGAGCTGTGGCGTTTTACATCC -3'
(R):5'- TGCGGACAGGCATTGCTG -3'
Posted On2015-07-21