Mutagenetix > Incidental Mutations

Incidental Mutation 'R4479:Olfr1243'

331384

Institutional Source

Beutler Lab

Gene Symbol

Olfr1243

Ensembl Gene

ENSMUSG00000075084

Gene Name

olfactory receptor 1243

Synonyms

GA_x6K02T2Q125-50972538-50971621, MOR231-4

MMRRC Submission

041736-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R4479 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

89525889-89531487 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89528170 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 80 (I80T)

Ref Sequence

ENSEMBL: ENSMUSP00000149464 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099775] [ENSMUST00000144885]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099775
AA Change: I80T

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000097363
Gene: ENSMUSG00000075084
AA Change: I80T

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	303	3.5e-45	PFAM
Pfam:7TM_GPCR_Srsx	33	300	1.2e-5	PFAM
Pfam:7tm_1	39	285	2.1e-15	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000144885
AA Change: I80T

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216635

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

95% (36/38)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc6	T	C	7: 46,005,239	T553A	possibly damaging	Het
Adamts20	C	T	15: 94,403,445	R66H	probably damaging	Het
Anks1b	A	G	10: 90,049,892	E150G	probably damaging	Het
Chp2	A	G	7: 122,220,918	D97G	probably benign	Het
Cnbd2	T	C	2: 156,333,653		probably benign	Het
D130040H23Rik	C	A	8: 69,302,503	H187N	possibly damaging	Het
Dusp15	A	G	2: 152,944,182	L135P	probably damaging	Het
Eif4g1	G	T	16: 20,678,843		probably benign	Het
Erlin2	G	T	8: 27,025,099	V10L	probably benign	Het
F830104G03Rik	A	G	3: 56,890,213	S98P	unknown	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Gm3159	T	C	14: 4,398,584	Y92H	probably damaging	Het
Ighv1-22	G	T	12: 114,746,663	A15E	possibly damaging	Het
Ints4	T	C	7: 97,484,971	S37P	probably damaging	Het
Irs1	G	A	1: 82,287,294	T1067I	probably damaging	Het
Lrrc28	C	T	7: 67,531,614		probably null	Het
Olfr1420	A	G	19: 11,896,558	Y179C	probably damaging	Het
Olfr206	G	A	16: 59,344,867	T278I	probably damaging	Het
Psg18	C	T	7: 18,350,862	S103N	probably benign	Het
Psma3	T	C	12: 70,984,781		probably benign	Het
Slc7a11	T	C	3: 50,417,963		probably benign	Het
Tas2r115	T	C	6: 132,737,532	D152G	probably damaging	Het
Tti1	A	T	2: 158,008,395	L308Q	possibly damaging	Het
Unc93b1	G	A	19: 3,935,236	A15T	probably benign	Het
Usp43	G	A	11: 67,856,407	R820C	possibly damaging	Het
Vmn2r68	TCC	TC	7: 85,221,550		probably null	Het
Vps8	A	T	16: 21,545,236		probably benign	Het
Wdr73	T	C	7: 80,893,221	E213G	probably benign	Het
Zfp286	C	G	11: 62,780,204	G348R	probably damaging	Het
Zkscan5	T	C	5: 145,211,174		probably benign	Het

Other mutations in Olfr1243

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Olfr1243	APN	2	89528207	missense	probably damaging	1.00
IGL01940:Olfr1243	APN	2	89527810	missense	probably damaging	0.99
IGL02553:Olfr1243	APN	2	89527931	missense	probably benign
R0105:Olfr1243	UTSW	2	89528363	missense	probably benign	0.00
R0105:Olfr1243	UTSW	2	89528363	missense	probably benign	0.00
R0607:Olfr1243	UTSW	2	89528107	missense	possibly damaging	0.88
R0764:Olfr1243	UTSW	2	89527996	missense	probably benign	0.05
R1779:Olfr1243	UTSW	2	89527645	missense	probably benign	0.15
R2221:Olfr1243	UTSW	2	89527937	missense	probably benign	0.05
R3853:Olfr1243	UTSW	2	89527573	missense	possibly damaging	0.94
R3886:Olfr1243	UTSW	2	89527732	missense	possibly damaging	0.81
R3887:Olfr1243	UTSW	2	89527732	missense	possibly damaging	0.81
R3888:Olfr1243	UTSW	2	89527732	missense	possibly damaging	0.81
R4431:Olfr1243	UTSW	2	89527643	missense	probably damaging	1.00
R6807:Olfr1243	UTSW	2	89527588	missense	probably damaging	1.00
R7025:Olfr1243	UTSW	2	89527604	missense	probably damaging	0.98
R7094:Olfr1243	UTSW	2	89527558	missense	probably damaging	1.00
R7144:Olfr1243	UTSW	2	89527557	missense	probably damaging	1.00
R7972:Olfr1243	UTSW	2	89527604	missense	probably benign	0.02
R8013:Olfr1243	UTSW	2	89527936	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- CCCGCTGATTCATGATGGTC -3'
(R):5'- ACAGAGCTACAATGTCACAGAATTC -3'

Sequencing Primer
(F):5'- CCCGCTGATTCATGATGGTCAAATAG -3'
(R):5'- GGACCTTACTCAAGATCCTGCTGG -3'

Posted On

2015-07-21