Incidental Mutation 'R4479:Dusp15'
ID331385
Institutional Source Beutler Lab
Gene Symbol Dusp15
Ensembl Gene ENSMUSG00000042662
Gene Namedual specificity phosphatase-like 15
SynonymsT-DSP10, LMW-DSP10
MMRRC Submission 041736-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R4479 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location152940997-152951698 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152944182 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 135 (L135P)
Ref Sequence ENSEMBL: ENSMUSP00000123090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037715] [ENSMUST00000109811] [ENSMUST00000123121]
Predicted Effect probably benign
Transcript: ENSMUST00000037715
SMART Domains Protein: ENSMUSP00000045815
Gene: ENSMUSG00000042662

DomainStartEndE-ValueType
Pfam:DSPc 12 89 1.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109811
SMART Domains Protein: ENSMUSP00000105436
Gene: ENSMUSG00000042662

DomainStartEndE-ValueType
DSPc 1 138 2.25e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123121
AA Change: L135P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123090
Gene: ENSMUSG00000042662
AA Change: L135P

DomainStartEndE-ValueType
DSPc 4 141 4.46e-42 SMART
low complexity region 165 176 N/A INTRINSIC
low complexity region 179 193 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185197
Meta Mutation Damage Score 0.9031 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has both protein-tyrosine phophatase activity and serine/threonine-specific phosphatase activity, and therefore is known as a dual specificity phosphatase. This protein may function in the differentiation of oligodendrocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adamts20 C T 15: 94,403,445 R66H probably damaging Het
Anks1b A G 10: 90,049,892 E150G probably damaging Het
Chp2 A G 7: 122,220,918 D97G probably benign Het
Cnbd2 T C 2: 156,333,653 probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Erlin2 G T 8: 27,025,099 V10L probably benign Het
F830104G03Rik A G 3: 56,890,213 S98P unknown Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Ighv1-22 G T 12: 114,746,663 A15E possibly damaging Het
Ints4 T C 7: 97,484,971 S37P probably damaging Het
Irs1 G A 1: 82,287,294 T1067I probably damaging Het
Lrrc28 C T 7: 67,531,614 probably null Het
Olfr1243 A G 2: 89,528,170 I80T possibly damaging Het
Olfr1420 A G 19: 11,896,558 Y179C probably damaging Het
Olfr206 G A 16: 59,344,867 T278I probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Psma3 T C 12: 70,984,781 probably benign Het
Slc7a11 T C 3: 50,417,963 probably benign Het
Tas2r115 T C 6: 132,737,532 D152G probably damaging Het
Tti1 A T 2: 158,008,395 L308Q possibly damaging Het
Unc93b1 G A 19: 3,935,236 A15T probably benign Het
Usp43 G A 11: 67,856,407 R820C possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp286 C G 11: 62,780,204 G348R probably damaging Het
Zkscan5 T C 5: 145,211,174 probably benign Het
Other mutations in Dusp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01893:Dusp15 APN 2 152949036 critical splice donor site probably null
PIT4305001:Dusp15 UTSW 2 152945476 missense probably benign 0.00
R0562:Dusp15 UTSW 2 152951348 missense possibly damaging 0.66
R1935:Dusp15 UTSW 2 152945421 splice site probably benign
R1936:Dusp15 UTSW 2 152945421 splice site probably benign
R2894:Dusp15 UTSW 2 152949085 missense probably benign 0.35
R4810:Dusp15 UTSW 2 152945454 missense probably damaging 1.00
R4849:Dusp15 UTSW 2 152949082 missense probably damaging 1.00
R5124:Dusp15 UTSW 2 152951355 start codon destroyed possibly damaging 0.79
R6341:Dusp15 UTSW 2 152946284 splice site probably null
R8749:Dusp15 UTSW 2 152946289 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGATAAACCCAGGATTGCC -3'
(R):5'- TTGTGACTTTCCTGAAGCCTG -3'

Sequencing Primer
(F):5'- AAACCCAGGATTGCCTTGTG -3'
(R):5'- CCTGAAGCCTGGGGTTGTC -3'
Posted On2015-07-21