Incidental Mutation 'R4479:Cnbd2'
ID331386
Institutional Source Beutler Lab
Gene Symbol Cnbd2
Ensembl Gene ENSMUSG00000038085
Gene Namecyclic nucleotide binding domain containing 2
Synonyms
MMRRC Submission 041736-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R4479 (G1)
Quality Score162
Status Validated
Chromosome2
Chromosomal Location156312299-156375638 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 156333653 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037096] [ENSMUST00000073942] [ENSMUST00000109580]
Predicted Effect probably benign
Transcript: ENSMUST00000037096
SMART Domains Protein: ENSMUSP00000041268
Gene: ENSMUSG00000038085

DomainStartEndE-ValueType
low complexity region 45 68 N/A INTRINSIC
cNMP 206 332 1.78e-7 SMART
Blast:cNMP 376 443 4e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000073942
SMART Domains Protein: ENSMUSP00000073598
Gene: ENSMUSG00000038085

DomainStartEndE-ValueType
cNMP 89 215 1.78e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109580
SMART Domains Protein: ENSMUSP00000105208
Gene: ENSMUSG00000038085

DomainStartEndE-ValueType
cNMP 77 203 1.78e-7 SMART
Blast:cNMP 247 314 3e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154227
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 95% (36/38)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced male fertility associated with impaired spermiogenesis and development of flagellum bending. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adamts20 C T 15: 94,403,445 R66H probably damaging Het
Anks1b A G 10: 90,049,892 E150G probably damaging Het
Chp2 A G 7: 122,220,918 D97G probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dusp15 A G 2: 152,944,182 L135P probably damaging Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Erlin2 G T 8: 27,025,099 V10L probably benign Het
F830104G03Rik A G 3: 56,890,213 S98P unknown Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Ighv1-22 G T 12: 114,746,663 A15E possibly damaging Het
Ints4 T C 7: 97,484,971 S37P probably damaging Het
Irs1 G A 1: 82,287,294 T1067I probably damaging Het
Lrrc28 C T 7: 67,531,614 probably null Het
Olfr1243 A G 2: 89,528,170 I80T possibly damaging Het
Olfr1420 A G 19: 11,896,558 Y179C probably damaging Het
Olfr206 G A 16: 59,344,867 T278I probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Psma3 T C 12: 70,984,781 probably benign Het
Slc7a11 T C 3: 50,417,963 probably benign Het
Tas2r115 T C 6: 132,737,532 D152G probably damaging Het
Tti1 A T 2: 158,008,395 L308Q possibly damaging Het
Unc93b1 G A 19: 3,935,236 A15T probably benign Het
Usp43 G A 11: 67,856,407 R820C possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp286 C G 11: 62,780,204 G348R probably damaging Het
Zkscan5 T C 5: 145,211,174 probably benign Het
Other mutations in Cnbd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Cnbd2 APN 2 156312614 unclassified probably benign
IGL01472:Cnbd2 APN 2 156375348 missense probably damaging 1.00
IGL01738:Cnbd2 APN 2 156375617 utr 3 prime probably benign
IGL01825:Cnbd2 APN 2 156338709 missense probably damaging 1.00
IGL03001:Cnbd2 APN 2 156333634 critical splice donor site probably null
IGL03057:Cnbd2 APN 2 156367672 missense possibly damaging 0.80
R1006:Cnbd2 UTSW 2 156328408 missense possibly damaging 0.86
R1080:Cnbd2 UTSW 2 156339273 missense probably benign 0.28
R1428:Cnbd2 UTSW 2 156339284 critical splice donor site probably null
R1592:Cnbd2 UTSW 2 156335402 missense probably benign 0.30
R1601:Cnbd2 UTSW 2 156333631 missense probably damaging 0.98
R1637:Cnbd2 UTSW 2 156373724 missense probably damaging 1.00
R2259:Cnbd2 UTSW 2 156335272 missense probably damaging 1.00
R2352:Cnbd2 UTSW 2 156335355 missense probably damaging 1.00
R4106:Cnbd2 UTSW 2 156335398 missense probably damaging 1.00
R4109:Cnbd2 UTSW 2 156335398 missense probably damaging 1.00
R4857:Cnbd2 UTSW 2 156367565 missense probably benign 0.01
R4893:Cnbd2 UTSW 2 156365184 missense probably damaging 0.97
R4899:Cnbd2 UTSW 2 156339221 missense probably benign 0.00
R5070:Cnbd2 UTSW 2 156335398 missense probably damaging 1.00
R5446:Cnbd2 UTSW 2 156367661 missense possibly damaging 0.95
R5784:Cnbd2 UTSW 2 156338657 missense probably damaging 1.00
R6197:Cnbd2 UTSW 2 156375574 missense possibly damaging 0.86
R7009:Cnbd2 UTSW 2 156320034 missense probably benign 0.00
R7221:Cnbd2 UTSW 2 156373661 missense probably benign 0.01
R7577:Cnbd2 UTSW 2 156328376 missense possibly damaging 0.93
R7699:Cnbd2 UTSW 2 156375406 missense probably benign 0.00
R8146:Cnbd2 UTSW 2 156328361 missense probably damaging 1.00
X0002:Cnbd2 UTSW 2 156338697 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GGTGATAACAAAACGGCTCTGG -3'
(R):5'- TCACTGTGATTAGAACTAAGTGGCC -3'

Sequencing Primer
(F):5'- AACGGCTCTGGGAGATGC -3'
(R):5'- CACTTCATAGTGCCCCTGGTG -3'
Posted On2015-07-21