Incidental Mutation 'R4479:Tti1'
ID331387
Institutional Source Beutler Lab
Gene Symbol Tti1
Ensembl Gene ENSMUSG00000027650
Gene NameTELO2 interacting protein 1
Synonyms2610036D13Rik
MMRRC Submission 041736-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R4479 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location157981803-158028433 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 158008395 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 308 (L308Q)
Ref Sequence ENSEMBL: ENSMUSP00000105148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029179] [ENSMUST00000109522] [ENSMUST00000124338]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029179
AA Change: L308Q

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029179
Gene: ENSMUSG00000027650
AA Change: L308Q

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 306 319 N/A INTRINSIC
low complexity region 401 411 N/A INTRINSIC
low complexity region 494 504 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
SCOP:d1gw5a_ 855 1044 3e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109522
AA Change: L308Q

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105148
Gene: ENSMUSG00000027650
AA Change: L308Q

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 306 319 N/A INTRINSIC
low complexity region 401 411 N/A INTRINSIC
low complexity region 494 504 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
SCOP:d1gw5a_ 855 1044 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124338
SMART Domains Protein: ENSMUSP00000116592
Gene: ENSMUSG00000027650

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126541
Meta Mutation Damage Score 0.4659 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 95% (36/38)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adamts20 C T 15: 94,403,445 R66H probably damaging Het
Anks1b A G 10: 90,049,892 E150G probably damaging Het
Chp2 A G 7: 122,220,918 D97G probably benign Het
Cnbd2 T C 2: 156,333,653 probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dusp15 A G 2: 152,944,182 L135P probably damaging Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Erlin2 G T 8: 27,025,099 V10L probably benign Het
F830104G03Rik A G 3: 56,890,213 S98P unknown Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Ighv1-22 G T 12: 114,746,663 A15E possibly damaging Het
Ints4 T C 7: 97,484,971 S37P probably damaging Het
Irs1 G A 1: 82,287,294 T1067I probably damaging Het
Lrrc28 C T 7: 67,531,614 probably null Het
Olfr1243 A G 2: 89,528,170 I80T possibly damaging Het
Olfr1420 A G 19: 11,896,558 Y179C probably damaging Het
Olfr206 G A 16: 59,344,867 T278I probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Psma3 T C 12: 70,984,781 probably benign Het
Slc7a11 T C 3: 50,417,963 probably benign Het
Tas2r115 T C 6: 132,737,532 D152G probably damaging Het
Unc93b1 G A 19: 3,935,236 A15T probably benign Het
Usp43 G A 11: 67,856,407 R820C possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp286 C G 11: 62,780,204 G348R probably damaging Het
Zkscan5 T C 5: 145,211,174 probably benign Het
Other mutations in Tti1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Tti1 APN 2 158008966 missense probably damaging 1.00
IGL00434:Tti1 APN 2 158008965 missense probably damaging 1.00
IGL00820:Tti1 APN 2 158008968 missense probably damaging 1.00
IGL00949:Tti1 APN 2 157982399 missense probably benign 0.00
IGL01080:Tti1 APN 2 157982459 missense probably damaging 1.00
IGL01084:Tti1 APN 2 157982459 missense probably damaging 1.00
IGL01339:Tti1 APN 2 158009130 missense possibly damaging 0.80
IGL01685:Tti1 APN 2 158000785 missense probably benign 0.01
IGL01866:Tti1 APN 2 158007698 missense probably benign 0.27
IGL01903:Tti1 APN 2 158000622 missense probably benign 0.01
IGL03142:Tti1 APN 2 158000677 missense probably damaging 0.99
IGL03173:Tti1 APN 2 158007012 unclassified probably benign
IGL03385:Tti1 APN 2 157993025 missense possibly damaging 0.86
R0413:Tti1 UTSW 2 157995476 missense probably benign 0.00
R0601:Tti1 UTSW 2 157993372 missense probably damaging 0.99
R1718:Tti1 UTSW 2 158008224 missense probably benign 0.40
R1760:Tti1 UTSW 2 157993035 missense possibly damaging 0.87
R1761:Tti1 UTSW 2 158007697 missense probably benign 0.01
R1968:Tti1 UTSW 2 158009046 missense possibly damaging 0.66
R2054:Tti1 UTSW 2 158007445 missense possibly damaging 0.79
R2131:Tti1 UTSW 2 158000743 missense probably benign
R3886:Tti1 UTSW 2 158008950 missense possibly damaging 0.74
R4647:Tti1 UTSW 2 158007020 unclassified probably benign
R5124:Tti1 UTSW 2 158008195 missense probably damaging 0.99
R5145:Tti1 UTSW 2 158008512 missense probably benign 0.30
R5852:Tti1 UTSW 2 158000673 missense probably damaging 1.00
R6667:Tti1 UTSW 2 158008427 nonsense probably null
R6714:Tti1 UTSW 2 158007051 missense possibly damaging 0.73
R6719:Tti1 UTSW 2 157982300 missense probably benign 0.01
R7143:Tti1 UTSW 2 158007676 missense probably benign
R7490:Tti1 UTSW 2 157995472 missense probably damaging 1.00
R7540:Tti1 UTSW 2 158007996 missense probably benign 0.43
R7549:Tti1 UTSW 2 158007168 missense probably damaging 1.00
R7641:Tti1 UTSW 2 158009029 missense possibly damaging 0.92
R7654:Tti1 UTSW 2 158008554 missense probably benign 0.00
R7716:Tti1 UTSW 2 158000698 missense probably benign 0.43
R7722:Tti1 UTSW 2 158007607 missense probably benign 0.00
R7898:Tti1 UTSW 2 157993470 missense probably benign 0.00
R8117:Tti1 UTSW 2 158007498 missense probably damaging 1.00
R8145:Tti1 UTSW 2 158007589 nonsense probably null
R8249:Tti1 UTSW 2 158000715 missense probably benign
R8712:Tti1 UTSW 2 157993010 missense probably damaging 1.00
R8784:Tti1 UTSW 2 158008594 missense probably benign 0.02
Z1176:Tti1 UTSW 2 157982429 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAAGATGTCAGCCAAGGC -3'
(R):5'- ACAGTGGGCTTCATCATGG -3'

Sequencing Primer
(F):5'- GGCTCTGCTGCCCACTAC -3'
(R):5'- TCACAGAGAAGCAGACTG -3'
Posted On2015-07-21