Incidental Mutation 'R4479:Tas2r115'
ID331392
Institutional Source Beutler Lab
Gene Symbol Tas2r115
Ensembl Gene ENSMUSG00000071149
Gene Nametaste receptor, type 2, member 115
SynonymsmGR15, T2R15, Tas2r15, mt2r49
MMRRC Submission 041736-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R4479 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location132737003-132738035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132737532 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 152 (D152G)
Ref Sequence ENSEMBL: ENSMUSP00000093043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095394]
Predicted Effect probably damaging
Transcript: ENSMUST00000095394
AA Change: D152G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093043
Gene: ENSMUSG00000071149
AA Change: D152G

DomainStartEndE-ValueType
Pfam:TAS2R 1 299 2.2e-84 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 95% (36/38)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adamts20 C T 15: 94,403,445 R66H probably damaging Het
Anks1b A G 10: 90,049,892 E150G probably damaging Het
Chp2 A G 7: 122,220,918 D97G probably benign Het
Cnbd2 T C 2: 156,333,653 probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dusp15 A G 2: 152,944,182 L135P probably damaging Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Erlin2 G T 8: 27,025,099 V10L probably benign Het
F830104G03Rik A G 3: 56,890,213 S98P unknown Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Ighv1-22 G T 12: 114,746,663 A15E possibly damaging Het
Ints4 T C 7: 97,484,971 S37P probably damaging Het
Irs1 G A 1: 82,287,294 T1067I probably damaging Het
Lrrc28 C T 7: 67,531,614 probably null Het
Olfr1243 A G 2: 89,528,170 I80T possibly damaging Het
Olfr1420 A G 19: 11,896,558 Y179C probably damaging Het
Olfr206 G A 16: 59,344,867 T278I probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Psma3 T C 12: 70,984,781 probably benign Het
Slc7a11 T C 3: 50,417,963 probably benign Het
Tti1 A T 2: 158,008,395 L308Q possibly damaging Het
Unc93b1 G A 19: 3,935,236 A15T probably benign Het
Usp43 G A 11: 67,856,407 R820C possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp286 C G 11: 62,780,204 G348R probably damaging Het
Zkscan5 T C 5: 145,211,174 probably benign Het
Other mutations in Tas2r115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Tas2r115 APN 6 132737778 missense probably benign 0.11
IGL01285:Tas2r115 APN 6 132737678 missense probably damaging 1.00
IGL01516:Tas2r115 APN 6 132737613 missense probably damaging 0.98
IGL01637:Tas2r115 APN 6 132737629 missense probably damaging 0.99
IGL02041:Tas2r115 APN 6 132737467 missense probably benign 0.13
IGL02178:Tas2r115 APN 6 132737308 missense probably benign 0.11
R0467:Tas2r115 UTSW 6 132737719 missense probably benign 0.02
R0553:Tas2r115 UTSW 6 132737959 missense probably benign 0.18
R1425:Tas2r115 UTSW 6 132737479 missense probably benign 0.02
R1770:Tas2r115 UTSW 6 132737971 missense probably damaging 1.00
R2120:Tas2r115 UTSW 6 132737507 missense possibly damaging 0.51
R2136:Tas2r115 UTSW 6 132737346 missense probably damaging 0.99
R2141:Tas2r115 UTSW 6 132737358 missense probably benign 0.43
R2142:Tas2r115 UTSW 6 132737358 missense probably benign 0.43
R4687:Tas2r115 UTSW 6 132737284 missense possibly damaging 0.80
R4948:Tas2r115 UTSW 6 132737161 missense probably damaging 1.00
R5097:Tas2r115 UTSW 6 132737253 missense probably damaging 1.00
R5856:Tas2r115 UTSW 6 132737538 missense possibly damaging 0.86
R6927:Tas2r115 UTSW 6 132737932 missense probably damaging 1.00
R7473:Tas2r115 UTSW 6 132737251 missense probably damaging 1.00
R7688:Tas2r115 UTSW 6 132737680 missense probably damaging 1.00
R8415:Tas2r115 UTSW 6 132737835 missense probably damaging 1.00
R8495:Tas2r115 UTSW 6 132737924 missense probably damaging 1.00
Z1088:Tas2r115 UTSW 6 132737081 nonsense probably null
Z1176:Tas2r115 UTSW 6 132737856 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTAGTACTGCATCTTCCTTACATG -3'
(R):5'- AGACTGATTCAGACTGCCTGG -3'

Sequencing Primer
(F):5'- GCATCTTCCTTACATGTTTCATAAGG -3'
(R):5'- TCAGACTGCCTGGAATATAAGC -3'
Posted On2015-07-21