Mutagenetix > Incidental Mutation

Incidental Mutation 'R4479:Abcc6'

331394

Institutional Source

Beutler Lab

Gene Symbol

Abcc6

Ensembl Gene

ENSMUSG00000030834

Gene Name

ATP-binding cassette, sub-family C (CFTR/MRP), member 6

Synonyms

Mrp6, DCC, Dyscalc1

MMRRC Submission

041736-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.874) question?

Stock #

R4479 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

45967555-46030302 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 46005239 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 553 (T553A)

Ref Sequence

ENSEMBL: ENSMUSP00000002850 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002850]

AlphaFold

Q9R1S7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000002850
AA Change: T553A

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: T553A

Domain	Start	End	E-Value	Type
transmembrane domain	44	61	N/A	INTRINSIC
transmembrane domain	81	100	N/A	INTRINSIC
transmembrane domain	110	129	N/A	INTRINSIC
transmembrane domain	142	161	N/A	INTRINSIC
transmembrane domain	171	193	N/A	INTRINSIC
Pfam:ABC_membrane	309	580	3.5e-29	PFAM
AAA	653	828	1.19e-9	SMART
low complexity region	871	885	N/A	INTRINSIC
Pfam:ABC_membrane	942	1211	2.5e-32	PFAM
AAA	1286	1473	1.71e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211780

Meta Mutation Damage Score

0.1114

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

95% (36/38)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts20	C	T	15: 94,403,445	R66H	probably damaging	Het
Anks1b	A	G	10: 90,049,892	E150G	probably damaging	Het
Chp2	A	G	7: 122,220,918	D97G	probably benign	Het
Cnbd2	T	C	2: 156,333,653		probably benign	Het
D130040H23Rik	C	A	8: 69,302,503	H187N	possibly damaging	Het
Dusp15	A	G	2: 152,944,182	L135P	probably damaging	Het
Eif4g1	G	T	16: 20,678,843		probably benign	Het
Erlin2	G	T	8: 27,025,099	V10L	probably benign	Het
F830104G03Rik	A	G	3: 56,890,213	S98P	unknown	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Gm3159	T	C	14: 4,398,584	Y92H	probably damaging	Het
Ighv1-22	G	T	12: 114,746,663	A15E	possibly damaging	Het
Ints4	T	C	7: 97,484,971	S37P	probably damaging	Het
Irs1	G	A	1: 82,287,294	T1067I	probably damaging	Het
Lrrc28	C	T	7: 67,531,614		probably null	Het
Olfr1243	A	G	2: 89,528,170	I80T	possibly damaging	Het
Olfr1420	A	G	19: 11,896,558	Y179C	probably damaging	Het
Olfr206	G	A	16: 59,344,867	T278I	probably damaging	Het
Psg18	C	T	7: 18,350,862	S103N	probably benign	Het
Psma3	T	C	12: 70,984,781		probably benign	Het
Slc7a11	T	C	3: 50,417,963		probably benign	Het
Tas2r115	T	C	6: 132,737,532	D152G	probably damaging	Het
Tti1	A	T	2: 158,008,395	L308Q	possibly damaging	Het
Unc93b1	G	A	19: 3,935,236	A15T	probably benign	Het
Usp43	G	A	11: 67,856,407	R820C	possibly damaging	Het
Vmn2r68	TCC	TC	7: 85,221,550		probably null	Het
Vps8	A	T	16: 21,545,236		probably benign	Het
Wdr73	T	C	7: 80,893,221	E213G	probably benign	Het
Zfp286	C	G	11: 62,780,204	G348R	probably damaging	Het
Zkscan5	T	C	5: 145,211,174		probably benign	Het

Other mutations in Abcc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01589:Abcc6	APN	7	46002672	splice site	probably benign
IGL01731:Abcc6	APN	7	46002610	missense	possibly damaging	0.71
IGL01743:Abcc6	APN	7	45996814	missense	probably benign	0.02
IGL01757:Abcc6	APN	7	45990281	splice site	probably benign
IGL01895:Abcc6	APN	7	46029058	missense	possibly damaging	0.88
IGL01942:Abcc6	APN	7	45986573	missense	possibly damaging	0.89
IGL02251:Abcc6	APN	7	45977416	missense	probably damaging	1.00
IGL02277:Abcc6	APN	7	46001061	missense	probably benign	0.00
IGL02548:Abcc6	APN	7	46005262	missense	probably damaging	0.98
IGL03063:Abcc6	APN	7	46016432	missense	probably benign
IGL03092:Abcc6	APN	7	45986470	missense	probably damaging	1.00
IGL03251:Abcc6	APN	7	45982237	unclassified	probably benign
R0057:Abcc6	UTSW	7	46020143	missense	probably benign	0.03
R0944:Abcc6	UTSW	7	46015505	missense	possibly damaging	0.81
R1019:Abcc6	UTSW	7	46014107	missense	possibly damaging	0.77
R1183:Abcc6	UTSW	7	45985253	missense	probably damaging	0.99
R1543:Abcc6	UTSW	7	46016504	missense	probably benign	0.01
R1550:Abcc6	UTSW	7	46005244	missense	probably benign	0.25
R1725:Abcc6	UTSW	7	45992357	missense	possibly damaging	0.76
R1907:Abcc6	UTSW	7	46014169	missense	probably benign	0.04
R1908:Abcc6	UTSW	7	46020134	splice site	probably null
R1909:Abcc6	UTSW	7	46020134	splice site	probably null
R2138:Abcc6	UTSW	7	45981051	missense	probably damaging	1.00
R2145:Abcc6	UTSW	7	45998741	missense	probably benign	0.01
R2402:Abcc6	UTSW	7	46015575	missense	probably benign	0.04
R3983:Abcc6	UTSW	7	45995289	missense	probably benign
R4013:Abcc6	UTSW	7	46018680	missense	probably benign	0.01
R4051:Abcc6	UTSW	7	45986563	missense	probably damaging	1.00
R4052:Abcc6	UTSW	7	45986563	missense	probably damaging	1.00
R4208:Abcc6	UTSW	7	45986563	missense	probably damaging	1.00
R4362:Abcc6	UTSW	7	45998832	splice site	probably benign
R4385:Abcc6	UTSW	7	45995328	missense	possibly damaging	0.93
R4399:Abcc6	UTSW	7	46002607	missense	probably benign
R4480:Abcc6	UTSW	7	46005239	missense	possibly damaging	0.60
R4780:Abcc6	UTSW	7	45996691	missense	probably benign
R4791:Abcc6	UTSW	7	45982160	missense	probably benign	0.00
R4895:Abcc6	UTSW	7	45980990	missense	possibly damaging	0.95
R4898:Abcc6	UTSW	7	45989687	missense	probably damaging	0.96
R4905:Abcc6	UTSW	7	45995225	missense	probably benign
R4941:Abcc6	UTSW	7	46012523	missense	probably benign	0.00
R5040:Abcc6	UTSW	7	46020154	missense	probably benign	0.04
R5128:Abcc6	UTSW	7	45989646	missense	probably benign	0.00
R5284:Abcc6	UTSW	7	45981059	missense	probably benign	0.05
R5328:Abcc6	UTSW	7	45992311	missense	probably benign	0.01
R5459:Abcc6	UTSW	7	45982183	missense	probably benign	0.00
R5543:Abcc6	UTSW	7	45989536	critical splice donor site	probably null
R6178:Abcc6	UTSW	7	46029044	missense	probably benign
R6228:Abcc6	UTSW	7	46030256	missense	probably benign	0.02
R6532:Abcc6	UTSW	7	45977379	missense	probably damaging	1.00
R6605:Abcc6	UTSW	7	45981057	missense	probably damaging	1.00
R7000:Abcc6	UTSW	7	46005522	missense	possibly damaging	0.60
R7067:Abcc6	UTSW	7	46018690	missense	probably benign
R7553:Abcc6	UTSW	7	45999121	missense	probably damaging	1.00
R7597:Abcc6	UTSW	7	45995237	missense	probably damaging	1.00
R7718:Abcc6	UTSW	7	45977392	missense	possibly damaging	0.91
R7781:Abcc6	UTSW	7	46005606	missense	probably damaging	1.00
R7798:Abcc6	UTSW	7	45976853	nonsense	probably null
R7896:Abcc6	UTSW	7	45977379	missense	probably damaging	1.00
R8098:Abcc6	UTSW	7	45996665	missense	probably damaging	1.00
R8443:Abcc6	UTSW	7	45980025	missense	probably damaging	1.00
R8773:Abcc6	UTSW	7	45985145	missense	probably benign
R8784:Abcc6	UTSW	7	46002601	missense	probably benign
R8802:Abcc6	UTSW	7	46008859	missense	probably damaging	0.99
R8807:Abcc6	UTSW	7	45999007	missense	possibly damaging	0.67
R9006:Abcc6	UTSW	7	46016396	missense	probably benign	0.00
R9127:Abcc6	UTSW	7	45979760	missense	probably damaging	1.00
R9475:Abcc6	UTSW	7	46016468	missense	probably damaging	1.00
R9480:Abcc6	UTSW	7	45979773	missense	probably damaging	1.00
R9535:Abcc6	UTSW	7	45977263	missense	probably damaging	1.00
R9642:Abcc6	UTSW	7	45990341	missense	probably benign	0.07
R9715:Abcc6	UTSW	7	45979935	missense	probably damaging	1.00
R9731:Abcc6	UTSW	7	46020236	nonsense	probably null
X0065:Abcc6	UTSW	7	46020197	missense	probably damaging	0.99
Z1176:Abcc6	UTSW	7	45979734	missense	probably damaging	1.00
Z1176:Abcc6	UTSW	7	45992306	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ATGGTCTGGCTCTACTCTAGC -3'
(R):5'- TTCTGGTCTCACTGCAGATGC -3'

Sequencing Primer
(F):5'- TCTGCTGACAGTGGTCCAG -3'
(R):5'- TCTCACTGCAGATGCCAGAG -3'

Posted On

2015-07-21