Mutagenetix > Incidental Mutation

Incidental Mutation 'R4479:Lrrc28'

331396

Institutional Source

Beutler Lab

Gene Symbol

Lrrc28

Ensembl Gene

ENSMUSG00000030556

Gene Name

leucine rich repeat containing 28

Synonyms

2210012C09Rik, 1300004K21Rik, 2310058O11Rik

MMRRC Submission

041736-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R4479 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

67513410-67645268 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 67531614 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000052177 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053950] [ENSMUST00000187953] [ENSMUST00000191035]

AlphaFold

Q3TX51

Predicted Effect

probably null
Transcript: ENSMUST00000053950

SMART Domains

Protein: ENSMUSP00000052177
Gene: ENSMUSG00000030556

Domain	Start	End	E-Value	Type
LRR	40	63	1.33e-1	SMART
LRR	64	86	3.24e0	SMART
LRR	87	109	1.06e1	SMART
LRR_TYP	110	132	6.67e-2	SMART
LRR	133	156	6.4e0	SMART
LRR	179	202	1.64e-1	SMART
low complexity region	304	318	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185818

Predicted Effect

probably benign
Transcript: ENSMUST00000187953

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188971

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190115

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190770

Predicted Effect

probably benign
Transcript: ENSMUST00000191035

SMART Domains

Protein: ENSMUSP00000140382
Gene: ENSMUSG00000030556

Domain	Start	End	E-Value	Type
LRR	40	63	1.33e-1	SMART
LRR	64	86	3.24e0	SMART
LRR	87	109	1.06e1	SMART
LRR	110	132	8.09e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191062

Meta Mutation Damage Score

0.9594

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

95% (36/38)

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc6	T	C	7: 46,005,239	T553A	possibly damaging	Het
Adamts20	C	T	15: 94,403,445	R66H	probably damaging	Het
Anks1b	A	G	10: 90,049,892	E150G	probably damaging	Het
Chp2	A	G	7: 122,220,918	D97G	probably benign	Het
Cnbd2	T	C	2: 156,333,653		probably benign	Het
D130040H23Rik	C	A	8: 69,302,503	H187N	possibly damaging	Het
Dusp15	A	G	2: 152,944,182	L135P	probably damaging	Het
Eif4g1	G	T	16: 20,678,843		probably benign	Het
Erlin2	G	T	8: 27,025,099	V10L	probably benign	Het
F830104G03Rik	A	G	3: 56,890,213	S98P	unknown	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Gm3159	T	C	14: 4,398,584	Y92H	probably damaging	Het
Ighv1-22	G	T	12: 114,746,663	A15E	possibly damaging	Het
Ints4	T	C	7: 97,484,971	S37P	probably damaging	Het
Irs1	G	A	1: 82,287,294	T1067I	probably damaging	Het
Olfr1243	A	G	2: 89,528,170	I80T	possibly damaging	Het
Olfr1420	A	G	19: 11,896,558	Y179C	probably damaging	Het
Olfr206	G	A	16: 59,344,867	T278I	probably damaging	Het
Psg18	C	T	7: 18,350,862	S103N	probably benign	Het
Psma3	T	C	12: 70,984,781		probably benign	Het
Slc7a11	T	C	3: 50,417,963		probably benign	Het
Tas2r115	T	C	6: 132,737,532	D152G	probably damaging	Het
Tti1	A	T	2: 158,008,395	L308Q	possibly damaging	Het
Unc93b1	G	A	19: 3,935,236	A15T	probably benign	Het
Usp43	G	A	11: 67,856,407	R820C	possibly damaging	Het
Vmn2r68	TCC	TC	7: 85,221,550		probably null	Het
Vps8	A	T	16: 21,545,236		probably benign	Het
Wdr73	T	C	7: 80,893,221	E213G	probably benign	Het
Zfp286	C	G	11: 62,780,204	G348R	probably damaging	Het
Zkscan5	T	C	5: 145,211,174		probably benign	Het

Other mutations in Lrrc28

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01548:Lrrc28	APN	7	67628294	critical splice donor site	probably null
IGL01583:Lrrc28	APN	7	67545475	splice site	probably null
IGL02033:Lrrc28	APN	7	67559857	critical splice donor site	probably null
IGL02483:Lrrc28	APN	7	67617983	splice site	probably benign
IGL02750:Lrrc28	APN	7	67531683	missense	probably damaging	0.96
BB002:Lrrc28	UTSW	7	67619109	missense	probably damaging	1.00
BB012:Lrrc28	UTSW	7	67619109	missense	probably damaging	1.00
R0549:Lrrc28	UTSW	7	67628342	splice site	probably benign
R0563:Lrrc28	UTSW	7	67545387	missense	probably damaging	1.00
R0650:Lrrc28	UTSW	7	67618085	missense	probably damaging	1.00
R0652:Lrrc28	UTSW	7	67618085	missense	probably damaging	1.00
R1557:Lrrc28	UTSW	7	67559929	missense	probably damaging	1.00
R1820:Lrrc28	UTSW	7	67641111	missense	probably damaging	0.98
R2149:Lrrc28	UTSW	7	67531682	missense	probably damaging	0.96
R2185:Lrrc28	UTSW	7	67545453	missense	possibly damaging	0.70
R5205:Lrrc28	UTSW	7	67531768	missense	probably benign	0.00
R7008:Lrrc28	UTSW	7	67595711	intron	probably benign
R7925:Lrrc28	UTSW	7	67619109	missense	probably damaging	1.00
R8323:Lrrc28	UTSW	7	67595707	missense	unknown
R8360:Lrrc28	UTSW	7	67641161	missense	probably benign	0.01
R8898:Lrrc28	UTSW	7	67628294	critical splice donor site	probably null
R8919:Lrrc28	UTSW	7	67619085	missense	possibly damaging	0.88
R9412:Lrrc28	UTSW	7	67531764	missense	probably damaging	1.00
Z1088:Lrrc28	UTSW	7	67529631	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- CTGAGACAGGAAGACCACTG -3'
(R):5'- TCATGACTAATGCCCCTGTG -3'

Sequencing Primer
(F):5'- GGAAGACCACTGACATACTCAATG -3'
(R):5'- TATGCAGCTGTGGCATCC -3'

Posted On

2015-07-21