Incidental Mutation 'R4479:Lrrc28'
ID331396
Institutional Source Beutler Lab
Gene Symbol Lrrc28
Ensembl Gene ENSMUSG00000030556
Gene Nameleucine rich repeat containing 28
Synonyms2210012C09Rik, 1300004K21Rik, 2310058O11Rik
MMRRC Submission 041736-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R4479 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location67513410-67645268 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 67531614 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000052177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053950] [ENSMUST00000187953] [ENSMUST00000191035]
Predicted Effect probably null
Transcript: ENSMUST00000053950
SMART Domains Protein: ENSMUSP00000052177
Gene: ENSMUSG00000030556

DomainStartEndE-ValueType
LRR 40 63 1.33e-1 SMART
LRR 64 86 3.24e0 SMART
LRR 87 109 1.06e1 SMART
LRR_TYP 110 132 6.67e-2 SMART
LRR 133 156 6.4e0 SMART
LRR 179 202 1.64e-1 SMART
low complexity region 304 318 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185818
Predicted Effect probably benign
Transcript: ENSMUST00000187953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190770
Predicted Effect probably benign
Transcript: ENSMUST00000191035
SMART Domains Protein: ENSMUSP00000140382
Gene: ENSMUSG00000030556

DomainStartEndE-ValueType
LRR 40 63 1.33e-1 SMART
LRR 64 86 3.24e0 SMART
LRR 87 109 1.06e1 SMART
LRR 110 132 8.09e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191062
Meta Mutation Damage Score 0.9594 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 95% (36/38)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adamts20 C T 15: 94,403,445 R66H probably damaging Het
Anks1b A G 10: 90,049,892 E150G probably damaging Het
Chp2 A G 7: 122,220,918 D97G probably benign Het
Cnbd2 T C 2: 156,333,653 probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dusp15 A G 2: 152,944,182 L135P probably damaging Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Erlin2 G T 8: 27,025,099 V10L probably benign Het
F830104G03Rik A G 3: 56,890,213 S98P unknown Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Ighv1-22 G T 12: 114,746,663 A15E possibly damaging Het
Ints4 T C 7: 97,484,971 S37P probably damaging Het
Irs1 G A 1: 82,287,294 T1067I probably damaging Het
Olfr1243 A G 2: 89,528,170 I80T possibly damaging Het
Olfr1420 A G 19: 11,896,558 Y179C probably damaging Het
Olfr206 G A 16: 59,344,867 T278I probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Psma3 T C 12: 70,984,781 probably benign Het
Slc7a11 T C 3: 50,417,963 probably benign Het
Tas2r115 T C 6: 132,737,532 D152G probably damaging Het
Tti1 A T 2: 158,008,395 L308Q possibly damaging Het
Unc93b1 G A 19: 3,935,236 A15T probably benign Het
Usp43 G A 11: 67,856,407 R820C possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp286 C G 11: 62,780,204 G348R probably damaging Het
Zkscan5 T C 5: 145,211,174 probably benign Het
Other mutations in Lrrc28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Lrrc28 APN 7 67628294 critical splice donor site probably null
IGL01583:Lrrc28 APN 7 67545475 splice site probably null
IGL02033:Lrrc28 APN 7 67559857 critical splice donor site probably null
IGL02483:Lrrc28 APN 7 67617983 splice site probably benign
IGL02750:Lrrc28 APN 7 67531683 missense probably damaging 0.96
BB002:Lrrc28 UTSW 7 67619109 missense probably damaging 1.00
BB012:Lrrc28 UTSW 7 67619109 missense probably damaging 1.00
R0549:Lrrc28 UTSW 7 67628342 splice site probably benign
R0563:Lrrc28 UTSW 7 67545387 missense probably damaging 1.00
R0650:Lrrc28 UTSW 7 67618085 missense probably damaging 1.00
R0652:Lrrc28 UTSW 7 67618085 missense probably damaging 1.00
R1557:Lrrc28 UTSW 7 67559929 missense probably damaging 1.00
R1820:Lrrc28 UTSW 7 67641111 missense probably damaging 0.98
R2149:Lrrc28 UTSW 7 67531682 missense probably damaging 0.96
R2185:Lrrc28 UTSW 7 67545453 missense possibly damaging 0.70
R5205:Lrrc28 UTSW 7 67531768 missense probably benign 0.00
R7008:Lrrc28 UTSW 7 67595711 intron probably benign
R7925:Lrrc28 UTSW 7 67619109 missense probably damaging 1.00
R8323:Lrrc28 UTSW 7 67595707 missense unknown
R8360:Lrrc28 UTSW 7 67641161 missense probably benign 0.01
Z1088:Lrrc28 UTSW 7 67529631 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CTGAGACAGGAAGACCACTG -3'
(R):5'- TCATGACTAATGCCCCTGTG -3'

Sequencing Primer
(F):5'- GGAAGACCACTGACATACTCAATG -3'
(R):5'- TATGCAGCTGTGGCATCC -3'
Posted On2015-07-21