Mutagenetix > Incidental Mutation

Incidental Mutation 'R4479:Vmn2r68'

331398

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r68

Ensembl Gene

ENSMUSG00000096861

Gene Name

vomeronasal 2, receptor 68

Synonyms

Vmn2r68-ps, EG620697

MMRRC Submission

041736-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.124) question?

Stock #

R4479 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

85221518-85237704 bp(-) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

TCC to TC at 85221550 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000129411 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061074]

AlphaFold

L7N2B3

Predicted Effect

probably null
Transcript: ENSMUST00000061074

SMART Domains

Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	77	463	4.5e-28	PFAM
Pfam:NCD3G	507	559	1.1e-18	PFAM
Pfam:7tm_3	589	827	3.7e-53	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

95% (36/38)

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc6	T	C	7: 46,005,239	T553A	possibly damaging	Het
Adamts20	C	T	15: 94,403,445	R66H	probably damaging	Het
Anks1b	A	G	10: 90,049,892	E150G	probably damaging	Het
Chp2	A	G	7: 122,220,918	D97G	probably benign	Het
Cnbd2	T	C	2: 156,333,653		probably benign	Het
D130040H23Rik	C	A	8: 69,302,503	H187N	possibly damaging	Het
Dusp15	A	G	2: 152,944,182	L135P	probably damaging	Het
Eif4g1	G	T	16: 20,678,843		probably benign	Het
Erlin2	G	T	8: 27,025,099	V10L	probably benign	Het
F830104G03Rik	A	G	3: 56,890,213	S98P	unknown	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Gm3159	T	C	14: 4,398,584	Y92H	probably damaging	Het
Ighv1-22	G	T	12: 114,746,663	A15E	possibly damaging	Het
Ints4	T	C	7: 97,484,971	S37P	probably damaging	Het
Irs1	G	A	1: 82,287,294	T1067I	probably damaging	Het
Lrrc28	C	T	7: 67,531,614		probably null	Het
Olfr1243	A	G	2: 89,528,170	I80T	possibly damaging	Het
Olfr1420	A	G	19: 11,896,558	Y179C	probably damaging	Het
Olfr206	G	A	16: 59,344,867	T278I	probably damaging	Het
Psg18	C	T	7: 18,350,862	S103N	probably benign	Het
Psma3	T	C	12: 70,984,781		probably benign	Het
Slc7a11	T	C	3: 50,417,963		probably benign	Het
Tas2r115	T	C	6: 132,737,532	D152G	probably damaging	Het
Tti1	A	T	2: 158,008,395	L308Q	possibly damaging	Het
Unc93b1	G	A	19: 3,935,236	A15T	probably benign	Het
Usp43	G	A	11: 67,856,407	R820C	possibly damaging	Het
Vps8	A	T	16: 21,545,236		probably benign	Het
Wdr73	T	C	7: 80,893,221	E213G	probably benign	Het
Zfp286	C	G	11: 62,780,204	G348R	probably damaging	Het
Zkscan5	T	C	5: 145,211,174		probably benign	Het

Other mutations in Vmn2r68

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01391:Vmn2r68	APN	7	85237611	missense	probably benign
IGL01477:Vmn2r68	APN	7	85233483	missense	probably damaging	1.00
IGL01600:Vmn2r68	APN	7	85222260	missense	probably benign	0.39
IGL01979:Vmn2r68	APN	7	85222117	missense	probably benign
IGL01999:Vmn2r68	APN	7	85222231	missense	probably damaging	1.00
IGL02269:Vmn2r68	APN	7	85221739	missense	possibly damaging	0.84
IGL02517:Vmn2r68	APN	7	85221945	nonsense	probably null
IGL02827:Vmn2r68	APN	7	85237592	missense	probably damaging	1.00
IGL02852:Vmn2r68	APN	7	85233387	missense	probably damaging	1.00
IGL02982:Vmn2r68	APN	7	85234441	missense	probably benign	0.12
IGL03099:Vmn2r68	APN	7	85222240	nonsense	probably null
IGL03166:Vmn2r68	APN	7	85222123	missense	probably benign	0.01
IGL03168:Vmn2r68	APN	7	85221764	missense	probably damaging	1.00
IGL03243:Vmn2r68	APN	7	85233755	missense	possibly damaging	0.66
F5770:Vmn2r68	UTSW	7	85221880	missense	probably benign	0.01
R0280:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0280:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0281:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0281:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0348:Vmn2r68	UTSW	7	85221676	missense	possibly damaging	0.50
R0390:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0390:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0722:Vmn2r68	UTSW	7	85221586	missense	possibly damaging	0.95
R1129:Vmn2r68	UTSW	7	85237504	splice site	probably null
R1136:Vmn2r68	UTSW	7	85222341	missense	possibly damaging	0.81
R1319:Vmn2r68	UTSW	7	85232492	missense	probably damaging	0.96
R1614:Vmn2r68	UTSW	7	85221738	missense	possibly damaging	0.93
R1682:Vmn2r68	UTSW	7	85233366	missense	possibly damaging	0.68
R1837:Vmn2r68	UTSW	7	85233678	missense	probably damaging	0.96
R1893:Vmn2r68	UTSW	7	85234659	nonsense	probably null
R1908:Vmn2r68	UTSW	7	85234052	missense	probably benign	0.09
R1909:Vmn2r68	UTSW	7	85234052	missense	probably benign	0.09
R1951:Vmn2r68	UTSW	7	85233894	missense	probably damaging	1.00
R2177:Vmn2r68	UTSW	7	85221915	missense	probably benign	0.01
R2178:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R2185:Vmn2r68	UTSW	7	85233693	nonsense	probably null
R2188:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R2282:Vmn2r68	UTSW	7	85221651	missense	possibly damaging	0.65
R2567:Vmn2r68	UTSW	7	85234595	missense	probably benign
R2869:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2869:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2873:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2874:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R3149:Vmn2r68	UTSW	7	85237667	missense	probably benign	0.00
R3401:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R3978:Vmn2r68	UTSW	7	85232462	missense	probably benign	0.00
R4399:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4401:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4421:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4478:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4495:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4628:Vmn2r68	UTSW	7	85234465	missense	probably benign	0.00
R4649:Vmn2r68	UTSW	7	85221535	missense	probably benign
R4654:Vmn2r68	UTSW	7	85233561	nonsense	probably null
R4793:Vmn2r68	UTSW	7	85234440	missense	probably benign	0.01
R5007:Vmn2r68	UTSW	7	85232414	missense	probably benign
R5021:Vmn2r68	UTSW	7	85233734	missense	possibly damaging	0.62
R5082:Vmn2r68	UTSW	7	85233868	missense	probably benign	0.12
R5177:Vmn2r68	UTSW	7	85221991	missense	probably damaging	0.99
R5221:Vmn2r68	UTSW	7	85221877	missense	probably damaging	1.00
R5514:Vmn2r68	UTSW	7	85237559	missense	possibly damaging	0.92
R5521:Vmn2r68	UTSW	7	85233718	missense	probably benign	0.03
R5563:Vmn2r68	UTSW	7	85222075	missense	probably damaging	1.00
R5664:Vmn2r68	UTSW	7	85233770	missense	probably benign	0.02
R5829:Vmn2r68	UTSW	7	85237604	missense	probably benign	0.00
R6016:Vmn2r68	UTSW	7	85222245	missense	probably damaging	0.99
R6356:Vmn2r68	UTSW	7	85233840	missense	possibly damaging	0.85
R6413:Vmn2r68	UTSW	7	85221765	missense	probably damaging	1.00
R6418:Vmn2r68	UTSW	7	85233707	missense	probably benign
R6699:Vmn2r68	UTSW	7	85232375	missense	possibly damaging	0.58
R7287:Vmn2r68	UTSW	7	85222252	missense	probably benign	0.33
R7319:Vmn2r68	UTSW	7	85233834	missense	probably benign
R7374:Vmn2r68	UTSW	7	85232399	missense	possibly damaging	0.66
R7585:Vmn2r68	UTSW	7	85232379	missense	probably damaging	1.00
R7605:Vmn2r68	UTSW	7	85233908	missense	probably benign	0.01
R7892:Vmn2r68	UTSW	7	85234514	missense	probably benign
R7979:Vmn2r68	UTSW	7	85234417	critical splice donor site	probably null
R8177:Vmn2r68	UTSW	7	85222214	nonsense	probably null
R8349:Vmn2r68	UTSW	7	85233577	missense	probably damaging	1.00
R8378:Vmn2r68	UTSW	7	85221900	missense	probably benign	0.00
R8397:Vmn2r68	UTSW	7	85237514	missense	possibly damaging	0.71
R8449:Vmn2r68	UTSW	7	85233577	missense	probably damaging	1.00
R8543:Vmn2r68	UTSW	7	85234440	missense	probably benign	0.01
R8680:Vmn2r68	UTSW	7	85222113	missense	possibly damaging	0.68
R9056:Vmn2r68	UTSW	7	85222212	missense	possibly damaging	0.71
R9342:Vmn2r68	UTSW	7	85233785	missense	probably benign	0.39
R9734:Vmn2r68	UTSW	7	85233549	missense	possibly damaging	0.54
V7581:Vmn2r68	UTSW	7	85221880	missense	probably benign	0.01
Z1176:Vmn2r68	UTSW	7	85221733	missense	probably damaging	1.00
Z1176:Vmn2r68	UTSW	7	85222081	missense	probably benign	0.27
Z1176:Vmn2r68	UTSW	7	85222099	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- ACATGTCTGTACTATCAACATGGC -3'
(R):5'- GCAGTGTCTGGATTACTTTCATC -3'

Sequencing Primer
(F):5'- GTTTATTCAACAAACTGTGGTACAGG -3'
(R):5'- GGATTACTTTCATCCCTGTCTACCAC -3'

Posted On

2015-07-21