Incidental Mutation 'R4479:Erlin2'
ID 331401
Institutional Source Beutler Lab
Gene Symbol Erlin2
Ensembl Gene ENSMUSG00000031483
Gene Name ER lipid raft associated 2
Synonyms Spfh2
MMRRC Submission 041736-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4479 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 27023261-27040328 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 27025099 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 10 (V10L)
Ref Sequence ENSEMBL: ENSMUSP00000147310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033873] [ENSMUST00000209520] [ENSMUST00000209563] [ENSMUST00000209795] [ENSMUST00000209976] [ENSMUST00000211043]
AlphaFold Q8BFZ9
Predicted Effect probably benign
Transcript: ENSMUST00000033873
AA Change: V10L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033873
Gene: ENSMUSG00000031483
AA Change: V10L

DomainStartEndE-ValueType
PHB 21 187 1.62e-36 SMART
low complexity region 235 246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209504
Predicted Effect probably benign
Transcript: ENSMUST00000209520
AA Change: V10L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000209563
AA Change: V10L

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000209795
AA Change: V10L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000209976
AA Change: V10L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000211043
AA Change: V10L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.1031 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SPFH domain-containing family of lipid raft-associated proteins. The encoded protein is localized to lipid rafts of the endoplasmic reticulum and plays a critical role in inositol 1,4,5-trisphosphate (IP3) signaling by mediating ER-associated degradation of activated IP3 receptors. Mutations in this gene are a cause of spastic paraplegia-18 (SPG18). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adamts20 C T 15: 94,403,445 R66H probably damaging Het
Anks1b A G 10: 90,049,892 E150G probably damaging Het
Chp2 A G 7: 122,220,918 D97G probably benign Het
Cnbd2 T C 2: 156,333,653 probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dusp15 A G 2: 152,944,182 L135P probably damaging Het
Eif4g1 G T 16: 20,678,843 probably benign Het
F830104G03Rik A G 3: 56,890,213 S98P unknown Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Ighv1-22 G T 12: 114,746,663 A15E possibly damaging Het
Ints4 T C 7: 97,484,971 S37P probably damaging Het
Irs1 G A 1: 82,287,294 T1067I probably damaging Het
Lrrc28 C T 7: 67,531,614 probably null Het
Olfr1243 A G 2: 89,528,170 I80T possibly damaging Het
Olfr1420 A G 19: 11,896,558 Y179C probably damaging Het
Olfr206 G A 16: 59,344,867 T278I probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Psma3 T C 12: 70,984,781 probably benign Het
Slc7a11 T C 3: 50,417,963 probably benign Het
Tas2r115 T C 6: 132,737,532 D152G probably damaging Het
Tti1 A T 2: 158,008,395 L308Q possibly damaging Het
Unc93b1 G A 19: 3,935,236 A15T probably benign Het
Usp43 G A 11: 67,856,407 R820C possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp286 C G 11: 62,780,204 G348R probably damaging Het
Zkscan5 T C 5: 145,211,174 probably benign Het
Other mutations in Erlin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01387:Erlin2 APN 8 27036548 missense probably benign
IGL01534:Erlin2 APN 8 27031957 nonsense probably null
IGL02719:Erlin2 APN 8 27029675 unclassified probably benign
R0193:Erlin2 UTSW 8 27031764 missense possibly damaging 0.82
R4878:Erlin2 UTSW 8 27027166 splice site probably null
R4965:Erlin2 UTSW 8 27029595 missense probably damaging 0.99
R5082:Erlin2 UTSW 8 27033407 missense probably damaging 0.98
R5939:Erlin2 UTSW 8 27036526 missense probably benign 0.24
R6172:Erlin2 UTSW 8 27036095 critical splice donor site probably null
R6705:Erlin2 UTSW 8 27036440 missense probably damaging 1.00
R7033:Erlin2 UTSW 8 27031764 missense probably benign 0.03
R7537:Erlin2 UTSW 8 27031772 critical splice donor site probably null
R8161:Erlin2 UTSW 8 27028942 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACAGTGAGTTGTAGATCTGG -3'
(R):5'- GCAATGGTTCCTTCAGATTTTGC -3'

Sequencing Primer
(F):5'- CAGTGAGTTGTAGATCTGGCAAGTAG -3'
(R):5'- TCAGCAGCACCTTAAAATACTAAAGG -3'
Posted On 2015-07-21