Incidental Mutation 'R4479:D130040H23Rik'
ID331402
Institutional Source Beutler Lab
Gene Symbol D130040H23Rik
Ensembl Gene ENSMUSG00000079038
Gene NameRIKEN cDNA D130040H23 gene
Synonyms
MMRRC Submission 041736-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R4479 (G1)
Quality Score211
Status Validated
Chromosome8
Chromosomal Location69271080-69314207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 69302503 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 187 (H187N)
Ref Sequence ENSEMBL: ENSMUSP00000077378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078257] [ENSMUST00000212549]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078257
AA Change: H187N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000077378
Gene: ENSMUSG00000079038
AA Change: H187N

DomainStartEndE-ValueType
internal_repeat_1 2 170 4.27e-17 PROSPERO
internal_repeat_1 199 366 4.27e-17 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212443
Predicted Effect possibly damaging
Transcript: ENSMUST00000212549
AA Change: T204K

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 95% (36/38)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adamts20 C T 15: 94,403,445 R66H probably damaging Het
Anks1b A G 10: 90,049,892 E150G probably damaging Het
Chp2 A G 7: 122,220,918 D97G probably benign Het
Cnbd2 T C 2: 156,333,653 probably benign Het
Dusp15 A G 2: 152,944,182 L135P probably damaging Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Erlin2 G T 8: 27,025,099 V10L probably benign Het
F830104G03Rik A G 3: 56,890,213 S98P unknown Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Ighv1-22 G T 12: 114,746,663 A15E possibly damaging Het
Ints4 T C 7: 97,484,971 S37P probably damaging Het
Irs1 G A 1: 82,287,294 T1067I probably damaging Het
Lrrc28 C T 7: 67,531,614 probably null Het
Olfr1243 A G 2: 89,528,170 I80T possibly damaging Het
Olfr1420 A G 19: 11,896,558 Y179C probably damaging Het
Olfr206 G A 16: 59,344,867 T278I probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Psma3 T C 12: 70,984,781 probably benign Het
Slc7a11 T C 3: 50,417,963 probably benign Het
Tas2r115 T C 6: 132,737,532 D152G probably damaging Het
Tti1 A T 2: 158,008,395 L308Q possibly damaging Het
Unc93b1 G A 19: 3,935,236 A15T probably benign Het
Usp43 G A 11: 67,856,407 R820C possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp286 C G 11: 62,780,204 G348R probably damaging Het
Zkscan5 T C 5: 145,211,174 probably benign Het
Other mutations in D130040H23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:D130040H23Rik APN 8 69300770 missense possibly damaging 0.59
R0164:D130040H23Rik UTSW 8 69302543 missense possibly damaging 0.61
R0164:D130040H23Rik UTSW 8 69302543 missense possibly damaging 0.61
R0269:D130040H23Rik UTSW 8 69300794 missense probably benign 0.00
R1534:D130040H23Rik UTSW 8 69302726 missense possibly damaging 0.62
R1565:D130040H23Rik UTSW 8 69303160 makesense probably null
R1648:D130040H23Rik UTSW 8 69302981 missense probably benign 0.04
R1869:D130040H23Rik UTSW 8 69302702 missense probably benign 0.22
R1870:D130040H23Rik UTSW 8 69302702 missense probably benign 0.22
R1871:D130040H23Rik UTSW 8 69302702 missense probably benign 0.22
R2025:D130040H23Rik UTSW 8 69302873 missense probably benign 0.29
R3418:D130040H23Rik UTSW 8 69302927 missense probably benign 0.27
R3810:D130040H23Rik UTSW 8 69302370 missense probably damaging 1.00
R3896:D130040H23Rik UTSW 8 69302958 missense probably damaging 1.00
R4477:D130040H23Rik UTSW 8 69302503 missense possibly damaging 0.95
R4478:D130040H23Rik UTSW 8 69302503 missense possibly damaging 0.95
R4480:D130040H23Rik UTSW 8 69302503 missense possibly damaging 0.95
R6849:D130040H23Rik UTSW 8 69302651 nonsense probably null
R7121:D130040H23Rik UTSW 8 69302279 missense probably damaging 0.99
R7821:D130040H23Rik UTSW 8 69300235 splice site probably null
R8269:D130040H23Rik UTSW 8 69303148 missense probably benign 0.00
R8747:D130040H23Rik UTSW 8 69303053 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCACAACAGAGTCACCTCCAGA -3'
(R):5'- TTGTGATGTGCAAAGGTCTTAC -3'

Sequencing Primer
(F):5'- GCCCTATGAATGTAATCAGTGTGC -3'
(R):5'- GTGCAAAGGTCTTACCACATTGAC -3'
Posted On2015-07-21