Incidental Mutation 'R4479:Usp43'
ID331407
Institutional Source Beutler Lab
Gene Symbol Usp43
Ensembl Gene ENSMUSG00000020905
Gene Nameubiquitin specific peptidase 43
Synonyms
MMRRC Submission 041736-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4479 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67854523-67922153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67856407 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 820 (R820C)
Ref Sequence ENSEMBL: ENSMUSP00000104317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021288] [ENSMUST00000108677]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021288
AA Change: R825C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021288
Gene: ENSMUSG00000020905
AA Change: R825C

DomainStartEndE-ValueType
low complexity region 8 54 N/A INTRINSIC
low complexity region 59 87 N/A INTRINSIC
Pfam:UCH 100 707 2.8e-61 PFAM
Pfam:UCH_1 101 297 1.3e-6 PFAM
Pfam:UCH_1 503 689 5.2e-13 PFAM
low complexity region 717 731 N/A INTRINSIC
low complexity region 958 972 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108677
AA Change: R820C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104317
Gene: ENSMUSG00000020905
AA Change: R820C

DomainStartEndE-ValueType
low complexity region 8 54 N/A INTRINSIC
low complexity region 59 87 N/A INTRINSIC
Pfam:UCH 100 702 3.5e-54 PFAM
Pfam:UCH_1 101 298 2.7e-7 PFAM
Pfam:UCH_1 503 684 1.2e-9 PFAM
low complexity region 712 726 N/A INTRINSIC
low complexity region 953 967 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129961
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 95% (36/38)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adamts20 C T 15: 94,403,445 R66H probably damaging Het
Anks1b A G 10: 90,049,892 E150G probably damaging Het
Chp2 A G 7: 122,220,918 D97G probably benign Het
Cnbd2 T C 2: 156,333,653 probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dusp15 A G 2: 152,944,182 L135P probably damaging Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Erlin2 G T 8: 27,025,099 V10L probably benign Het
F830104G03Rik A G 3: 56,890,213 S98P unknown Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Ighv1-22 G T 12: 114,746,663 A15E possibly damaging Het
Ints4 T C 7: 97,484,971 S37P probably damaging Het
Irs1 G A 1: 82,287,294 T1067I probably damaging Het
Lrrc28 C T 7: 67,531,614 probably null Het
Olfr1243 A G 2: 89,528,170 I80T possibly damaging Het
Olfr1420 A G 19: 11,896,558 Y179C probably damaging Het
Olfr206 G A 16: 59,344,867 T278I probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Psma3 T C 12: 70,984,781 probably benign Het
Slc7a11 T C 3: 50,417,963 probably benign Het
Tas2r115 T C 6: 132,737,532 D152G probably damaging Het
Tti1 A T 2: 158,008,395 L308Q possibly damaging Het
Unc93b1 G A 19: 3,935,236 A15T probably benign Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp286 C G 11: 62,780,204 G348R probably damaging Het
Zkscan5 T C 5: 145,211,174 probably benign Het
Other mutations in Usp43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Usp43 APN 11 67891419 missense probably benign 0.08
IGL01536:Usp43 APN 11 67855938 missense probably benign 0.01
IGL01754:Usp43 APN 11 67856181 missense probably benign 0.06
IGL02057:Usp43 APN 11 67856287 missense probably benign 0.02
IGL02638:Usp43 APN 11 67855755 missense probably benign 0.06
IGL03105:Usp43 APN 11 67879976 missense possibly damaging 0.82
IGL03155:Usp43 APN 11 67876489 missense probably damaging 1.00
IGL03380:Usp43 APN 11 67875316 missense possibly damaging 0.67
R0207:Usp43 UTSW 11 67876499 missense probably damaging 1.00
R0308:Usp43 UTSW 11 67880140 missense probably damaging 1.00
R0350:Usp43 UTSW 11 67876498 missense probably damaging 1.00
R0479:Usp43 UTSW 11 67897274 missense possibly damaging 0.96
R1451:Usp43 UTSW 11 67856181 missense probably benign 0.01
R1686:Usp43 UTSW 11 67887767 missense probably damaging 0.99
R1750:Usp43 UTSW 11 67879953 missense probably damaging 1.00
R1956:Usp43 UTSW 11 67904333 missense probably damaging 1.00
R2107:Usp43 UTSW 11 67855740 frame shift probably null
R2108:Usp43 UTSW 11 67855740 frame shift probably null
R2112:Usp43 UTSW 11 67921710 missense probably damaging 1.00
R2162:Usp43 UTSW 11 67879969 missense probably damaging 1.00
R2336:Usp43 UTSW 11 67891432 nonsense probably null
R4031:Usp43 UTSW 11 67913833 missense probably damaging 1.00
R4355:Usp43 UTSW 11 67891464 missense probably benign 0.01
R4410:Usp43 UTSW 11 67855890 missense probably benign 0.00
R4569:Usp43 UTSW 11 67875352 nonsense probably null
R4569:Usp43 UTSW 11 67898962 missense probably damaging 1.00
R4737:Usp43 UTSW 11 67855505 missense probably damaging 1.00
R5395:Usp43 UTSW 11 67897358 critical splice acceptor site probably null
R5466:Usp43 UTSW 11 67913883 missense probably damaging 0.99
R5686:Usp43 UTSW 11 67921916 unclassified probably benign
R6106:Usp43 UTSW 11 67879907 missense probably benign 0.00
R7205:Usp43 UTSW 11 67883284 missense probably null 1.00
R7360:Usp43 UTSW 11 67876329 intron probably null
R7426:Usp43 UTSW 11 67893016 missense possibly damaging 0.60
R7755:Usp43 UTSW 11 67891468 missense possibly damaging 0.94
R8054:Usp43 UTSW 11 67891458 missense probably damaging 0.96
Z1088:Usp43 UTSW 11 67856040 missense probably benign 0.39
Z1176:Usp43 UTSW 11 67921841 missense unknown
Z1177:Usp43 UTSW 11 67855808 missense possibly damaging 0.56
Z1177:Usp43 UTSW 11 67922032 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGTTGTTCCTTGCCCAATGG -3'
(R):5'- TACACCATTGCTTGAAGGCTG -3'

Sequencing Primer
(F):5'- AATGGCTCGACCGCTGTC -3'
(R):5'- CAGGGCATATATCCCTTAGCAGGTG -3'
Posted On2015-07-21