Incidental Mutation 'R4479:Psma3'
ID331408
Institutional Source Beutler Lab
Gene Symbol Psma3
Ensembl Gene ENSMUSG00000060073
Gene Nameproteasome (prosome, macropain) subunit, alpha type 3
SynonymsLmpc8
MMRRC Submission 041736-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R4479 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location70974621-70996347 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 70984781 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000071704] [ENSMUST00000160027] [ENSMUST00000160864] [ENSMUST00000162626] [ENSMUST00000162851]
Predicted Effect probably benign
Transcript: ENSMUST00000071704
Predicted Effect probably benign
Transcript: ENSMUST00000160027
SMART Domains Protein: ENSMUSP00000125548
Gene: ENSMUSG00000060073

DomainStartEndE-ValueType
Proteasome_A_N 8 30 9.72e-9 SMART
Pfam:Proteasome 31 217 6.2e-53 PFAM
low complexity region 241 253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160683
Predicted Effect probably benign
Transcript: ENSMUST00000160864
SMART Domains Protein: ENSMUSP00000124894
Gene: ENSMUSG00000060073

DomainStartEndE-ValueType
Pfam:Proteasome 1 142 1.7e-38 PFAM
low complexity region 166 178 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162626
Predicted Effect probably benign
Transcript: ENSMUST00000162851
SMART Domains Protein: ENSMUSP00000124082
Gene: ENSMUSG00000060073

DomainStartEndE-ValueType
Proteasome_A_N 8 30 9.72e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162898
SMART Domains Protein: ENSMUSP00000125490
Gene: ENSMUSG00000060073

DomainStartEndE-ValueType
Pfam:Proteasome 1 53 3.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163035
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Two alternative transcripts encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adamts20 C T 15: 94,403,445 R66H probably damaging Het
Anks1b A G 10: 90,049,892 E150G probably damaging Het
Chp2 A G 7: 122,220,918 D97G probably benign Het
Cnbd2 T C 2: 156,333,653 probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dusp15 A G 2: 152,944,182 L135P probably damaging Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Erlin2 G T 8: 27,025,099 V10L probably benign Het
F830104G03Rik A G 3: 56,890,213 S98P unknown Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Ighv1-22 G T 12: 114,746,663 A15E possibly damaging Het
Ints4 T C 7: 97,484,971 S37P probably damaging Het
Irs1 G A 1: 82,287,294 T1067I probably damaging Het
Lrrc28 C T 7: 67,531,614 probably null Het
Olfr1243 A G 2: 89,528,170 I80T possibly damaging Het
Olfr1420 A G 19: 11,896,558 Y179C probably damaging Het
Olfr206 G A 16: 59,344,867 T278I probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Slc7a11 T C 3: 50,417,963 probably benign Het
Tas2r115 T C 6: 132,737,532 D152G probably damaging Het
Tti1 A T 2: 158,008,395 L308Q possibly damaging Het
Unc93b1 G A 19: 3,935,236 A15T probably benign Het
Usp43 G A 11: 67,856,407 R820C possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp286 C G 11: 62,780,204 G348R probably damaging Het
Zkscan5 T C 5: 145,211,174 probably benign Het
Other mutations in Psma3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01898:Psma3 APN 12 70984674 missense probably benign 0.17
R0316:Psma3 UTSW 12 70983389 missense probably benign 0.01
R0669:Psma3 UTSW 12 70988495 splice site probably benign
R1933:Psma3 UTSW 12 70984694 missense probably benign 0.22
R2288:Psma3 UTSW 12 70994371 missense possibly damaging 0.70
R3745:Psma3 UTSW 12 70978748 missense possibly damaging 0.86
R5260:Psma3 UTSW 12 70984642 unclassified probably benign
R5384:Psma3 UTSW 12 70974765 missense probably damaging 1.00
R5457:Psma3 UTSW 12 70984565 missense probably benign
R5794:Psma3 UTSW 12 70990497 missense probably benign 0.00
R8348:Psma3 UTSW 12 70988476 missense probably damaging 1.00
R8448:Psma3 UTSW 12 70988476 missense probably damaging 1.00
R8814:Psma3 UTSW 12 70978806 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TTTAGGTCCAACTTCGGCTATAAC -3'
(R):5'- CCTGGTGAGAAGCTGATCTG -3'

Sequencing Primer
(F):5'- AGGTCCAACTTCGGCTATAACATTCC -3'
(R):5'- CTGGTGAGAAGCTGATCTGGGAAC -3'
Posted On2015-07-21