Mutagenetix > Incidental Mutations

Incidental Mutation 'R4479:Vps8'

331412

Institutional Source

Beutler Lab

Gene Symbol

Vps8

Ensembl Gene

ENSMUSG00000033653

Gene Name

VPS8 CORVET complex subunit

Synonyms

MMRRC Submission

041736-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4479 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21423118-21644680 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to T at 21545236 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000114139 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096191] [ENSMUST00000096192] [ENSMUST00000115397] [ENSMUST00000117598] [ENSMUST00000118138] [ENSMUST00000118923] [ENSMUST00000122235] [ENSMUST00000156580]

Predicted Effect

probably benign
Transcript: ENSMUST00000096191

SMART Domains

Protein: ENSMUSP00000093905
Gene: ENSMUSG00000033653

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	296	1e-8	SMART
Blast:WD40	184	225	7e-22	BLAST
Blast:WD40	228	268	5e-20	BLAST
Pfam:Vps8	610	794	1.7e-61	PFAM
low complexity region	992	1007	N/A	INTRINSIC
low complexity region	1085	1097	N/A	INTRINSIC
low complexity region	1126	1137	N/A	INTRINSIC
Blast:RING	1257	1277	1e-5	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000096192

SMART Domains

Protein: ENSMUSP00000093906
Gene: ENSMUSG00000033653

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	298	1e-8	SMART
Blast:WD40	186	227	8e-22	BLAST
Blast:WD40	230	270	5e-20	BLAST
Pfam:Vps8	612	796	1.4e-61	PFAM
low complexity region	969	979	N/A	INTRINSIC
low complexity region	1057	1069	N/A	INTRINSIC
low complexity region	1098	1109	N/A	INTRINSIC
RING	1229	1280	1.23e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115397

SMART Domains

Protein: ENSMUSP00000111055
Gene: ENSMUSG00000033653

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	298	8e-9	SMART
Blast:WD40	186	227	8e-22	BLAST
Blast:WD40	230	270	5e-20	BLAST
Pfam:Vps8	613	796	1.3e-61	PFAM
low complexity region	994	1009	N/A	INTRINSIC
low complexity region	1087	1099	N/A	INTRINSIC
low complexity region	1128	1139	N/A	INTRINSIC
RING	1259	1310	1.23e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117598

SMART Domains

Protein: ENSMUSP00000112937
Gene: ENSMUSG00000033653

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	296	1e-8	SMART
Blast:WD40	184	225	8e-22	BLAST
Blast:WD40	228	268	5e-20	BLAST
Pfam:Vps8	610	794	1.9e-61	PFAM
low complexity region	992	1007	N/A	INTRINSIC
low complexity region	1085	1097	N/A	INTRINSIC
low complexity region	1126	1137	N/A	INTRINSIC
RING	1257	1308	1.23e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000118138

SMART Domains

Protein: ENSMUSP00000113447
Gene: ENSMUSG00000033653

Domain	Start	End	E-Value	Type
Pfam:Vps8	1	76	7.7e-21	PFAM
low complexity region	274	289	N/A	INTRINSIC
low complexity region	367	379	N/A	INTRINSIC
low complexity region	408	419	N/A	INTRINSIC
RING	539	590	1.23e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000118923

SMART Domains

Protein: ENSMUSP00000112636
Gene: ENSMUSG00000033653

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	298	9e-9	SMART
Blast:WD40	186	227	8e-22	BLAST
Blast:WD40	230	270	5e-20	BLAST
Pfam:Vps8	612	796	1.9e-61	PFAM
low complexity region	969	979	N/A	INTRINSIC
low complexity region	1057	1069	N/A	INTRINSIC
low complexity region	1098	1109	N/A	INTRINSIC
RING	1229	1280	1.23e-4	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000122235
AA Change: D411V

SMART Domains

Protein: ENSMUSP00000112622
Gene: ENSMUSG00000033653
AA Change: D411V

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
WD40	184	225	2.66e0	SMART
WD40	228	269	5.5e1	SMART
low complexity region	371	386	N/A	INTRINSIC
low complexity region	480	491	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000125487

SMART Domains

Protein: ENSMUSP00000114719
Gene: ENSMUSG00000033653

Domain	Start	End	E-Value	Type
Pfam:Vps8	182	365	8.5e-62	PFAM
low complexity region	563	578	N/A	INTRINSIC
low complexity region	656	668	N/A	INTRINSIC
low complexity region	697	708	N/A	INTRINSIC
RING	828	879	1.23e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000156580

Predicted Effect

unknown
Transcript: ENSMUST00000232357
AA Change: D84V

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

95% (36/38)

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc6	T	C	7: 46,005,239	T553A	possibly damaging	Het
Adamts20	C	T	15: 94,403,445	R66H	probably damaging	Het
Anks1b	A	G	10: 90,049,892	E150G	probably damaging	Het
Chp2	A	G	7: 122,220,918	D97G	probably benign	Het
Cnbd2	T	C	2: 156,333,653		probably benign	Het
D130040H23Rik	C	A	8: 69,302,503	H187N	possibly damaging	Het
Dusp15	A	G	2: 152,944,182	L135P	probably damaging	Het
Eif4g1	G	T	16: 20,678,843		probably benign	Het
Erlin2	G	T	8: 27,025,099	V10L	probably benign	Het
F830104G03Rik	A	G	3: 56,890,213	S98P	unknown	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Gm3159	T	C	14: 4,398,584	Y92H	probably damaging	Het
Ighv1-22	G	T	12: 114,746,663	A15E	possibly damaging	Het
Ints4	T	C	7: 97,484,971	S37P	probably damaging	Het
Irs1	G	A	1: 82,287,294	T1067I	probably damaging	Het
Lrrc28	C	T	7: 67,531,614		probably null	Het
Olfr1243	A	G	2: 89,528,170	I80T	possibly damaging	Het
Olfr1420	A	G	19: 11,896,558	Y179C	probably damaging	Het
Olfr206	G	A	16: 59,344,867	T278I	probably damaging	Het
Psg18	C	T	7: 18,350,862	S103N	probably benign	Het
Psma3	T	C	12: 70,984,781		probably benign	Het
Slc7a11	T	C	3: 50,417,963		probably benign	Het
Tas2r115	T	C	6: 132,737,532	D152G	probably damaging	Het
Tti1	A	T	2: 158,008,395	L308Q	possibly damaging	Het
Unc93b1	G	A	19: 3,935,236	A15T	probably benign	Het
Usp43	G	A	11: 67,856,407	R820C	possibly damaging	Het
Vmn2r68	TCC	TC	7: 85,221,550		probably null	Het
Wdr73	T	C	7: 80,893,221	E213G	probably benign	Het
Zfp286	C	G	11: 62,780,204	G348R	probably damaging	Het
Zkscan5	T	C	5: 145,211,174		probably benign	Het

Other mutations in Vps8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00500:Vps8	APN	16	21442334	missense	possibly damaging	0.47
IGL00596:Vps8	APN	16	21448412	splice site	probably benign
IGL00985:Vps8	APN	16	21477584	splice site	probably benign
IGL01356:Vps8	APN	16	21517357	critical splice donor site	probably null
IGL01375:Vps8	APN	16	21559372	nonsense	probably null
IGL01643:Vps8	APN	16	21518222	missense	possibly damaging	0.92
IGL02159:Vps8	APN	16	21466484	missense	possibly damaging	0.69
IGL02214:Vps8	APN	16	21517285	missense	probably damaging	1.00
IGL02465:Vps8	APN	16	21521903	missense	probably damaging	1.00
IGL02651:Vps8	APN	16	21517336	missense	probably damaging	0.99
IGL03174:Vps8	APN	16	21466463	missense	probably damaging	1.00
IGL03337:Vps8	APN	16	21563168	missense	probably benign
IGL03383:Vps8	APN	16	21435823	critical splice donor site	probably null
IGL03402:Vps8	APN	16	21448398	missense	possibly damaging	0.68
empires	UTSW	16	21581548	nonsense	probably null
porky	UTSW	16	21461238	missense	probably benign	0.32
realm	UTSW	16	21545236	intron	probably benign
realms	UTSW	16	21444188	splice site	probably null
Reich	UTSW	16	21478439	missense	probably benign	0.29
reichen	UTSW	16	21506825	splice site	probably benign
IGL03052:Vps8	UTSW	16	21448365	missense	probably damaging	0.99
PIT4677001:Vps8	UTSW	16	21500334	missense	possibly damaging	0.94
R0066:Vps8	UTSW	16	21477523	missense	possibly damaging	0.77
R0066:Vps8	UTSW	16	21477523	missense	possibly damaging	0.77
R0125:Vps8	UTSW	16	21470154	missense	probably benign	0.00
R0137:Vps8	UTSW	16	21504386	splice site	probably benign
R0362:Vps8	UTSW	16	21608227	intron	probably benign
R0384:Vps8	UTSW	16	21506825	splice site	probably benign
R0492:Vps8	UTSW	16	21442357	missense	probably damaging	1.00
R0525:Vps8	UTSW	16	21540109	critical splice donor site	probably null
R0531:Vps8	UTSW	16	21459811	intron	probably benign
R0605:Vps8	UTSW	16	21559337	missense	probably benign	0.00
R0636:Vps8	UTSW	16	21434933	missense	probably benign	0.32
R0707:Vps8	UTSW	16	21442357	missense	probably damaging	1.00
R0840:Vps8	UTSW	16	21456321	missense	probably damaging	0.99
R1170:Vps8	UTSW	16	21459820	intron	probably benign
R1203:Vps8	UTSW	16	21511557	missense	probably damaging	1.00
R1482:Vps8	UTSW	16	21581598	missense	probably benign	0.00
R1531:Vps8	UTSW	16	21466476	nonsense	probably null
R1642:Vps8	UTSW	16	21581579	missense	probably benign
R1956:Vps8	UTSW	16	21461142	missense	probably damaging	1.00
R2201:Vps8	UTSW	16	21576757	missense	probably damaging	1.00
R2287:Vps8	UTSW	16	21568413	missense	probably damaging	1.00
R2423:Vps8	UTSW	16	21559337	missense	probably benign	0.00
R3151:Vps8	UTSW	16	21442373	missense	probably benign	0.04
R3943:Vps8	UTSW	16	21470123	missense	probably damaging	1.00
R3944:Vps8	UTSW	16	21470123	missense	probably damaging	1.00
R4043:Vps8	UTSW	16	21526396	missense	probably damaging	1.00
R4302:Vps8	UTSW	16	21495914	missense	probably damaging	1.00
R4398:Vps8	UTSW	16	21504466	missense	probably damaging	1.00
R4477:Vps8	UTSW	16	21545236	intron	probably benign
R4478:Vps8	UTSW	16	21545236	intron	probably benign
R4480:Vps8	UTSW	16	21545236	intron	probably benign
R4571:Vps8	UTSW	16	21435775	missense	probably damaging	1.00
R4653:Vps8	UTSW	16	21500210	missense	probably damaging	1.00
R4664:Vps8	UTSW	16	21444188	splice site	probably null
R4713:Vps8	UTSW	16	21442439	missense	probably damaging	1.00
R4726:Vps8	UTSW	16	21448404	splice site	probably null
R4959:Vps8	UTSW	16	21459786	missense	probably damaging	1.00
R4973:Vps8	UTSW	16	21459786	missense	probably damaging	1.00
R4975:Vps8	UTSW	16	21466469	missense	probably damaging	1.00
R4992:Vps8	UTSW	16	21461408	missense	possibly damaging	0.52
R5144:Vps8	UTSW	16	21559353	missense	probably damaging	1.00
R5168:Vps8	UTSW	16	21457445	missense	probably damaging	0.99
R5168:Vps8	UTSW	16	21533099	missense	probably benign	0.05
R5222:Vps8	UTSW	16	21581548	nonsense	probably null
R5231:Vps8	UTSW	16	21576725	missense	probably damaging	1.00
R5876:Vps8	UTSW	16	21461439	critical splice donor site	probably null
R5963:Vps8	UTSW	16	21470121	missense	possibly damaging	0.48
R6010:Vps8	UTSW	16	21545205	intron	probably benign
R6023:Vps8	UTSW	16	21461238	missense	probably benign	0.32
R6173:Vps8	UTSW	16	21495932	splice site	probably null
R6185:Vps8	UTSW	16	21470141	missense	probably damaging	0.98
R6264:Vps8	UTSW	16	21559349	nonsense	probably null
R6409:Vps8	UTSW	16	21478439	missense	probably benign	0.29
R6522:Vps8	UTSW	16	21442379	missense	probably damaging	0.99
R6528:Vps8	UTSW	16	21554125	nonsense	probably null
R6784:Vps8	UTSW	16	21563207	missense	probably benign	0.01
R7040:Vps8	UTSW	16	21575022	missense	probably damaging	1.00
R7072:Vps8	UTSW	16	21581579	missense	probably benign
R7103:Vps8	UTSW	16	21526441	missense	probably damaging	1.00
R7149:Vps8	UTSW	16	21459776	missense	probably damaging	1.00
R7195:Vps8	UTSW	16	21456282	missense	probably damaging	1.00
R7206:Vps8	UTSW	16	21457421	missense	probably damaging	1.00
R7403:Vps8	UTSW	16	21434972	missense	possibly damaging	0.78
R7782:Vps8	UTSW	16	21511558	missense	possibly damaging	0.89
R7806:Vps8	UTSW	16	21459751	missense	probably damaging	1.00
R7846:Vps8	UTSW	16	21532320	missense	probably benign	0.01
R7943:Vps8	UTSW	16	21477872	missense	possibly damaging	0.66
R8075:Vps8	UTSW	16	21521894	missense	probably damaging	0.99
R8190:Vps8	UTSW	16	21575030	missense	possibly damaging	0.73
R8307:Vps8	UTSW	16	21495902	missense	probably benign	0.02
R8483:Vps8	UTSW	16	21575013	missense	probably damaging	0.98
R8814:Vps8	UTSW	16	21576650	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTTGAGATCCCTCTTCTTATGAAC -3'
(R):5'- TGGATGTGACAGGACAGCTG -3'

Sequencing Primer
(F):5'- CGCATACAATGTGTTTTTGTCATATC -3'
(R):5'- ATGTGACAGGACAGCTGCTCTC -3'

Posted On

2015-07-21