Incidental Mutation 'R4479:Olfr206'
ID331413
Institutional Source Beutler Lab
Gene Symbol Olfr206
Ensembl Gene ENSMUSG00000066257
Gene Nameolfactory receptor 206
SynonymsMOR182-4, GA_x54KRFPKG5P-55560552-55559632
MMRRC Submission 041736-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4479 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location59344675-59349246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59344867 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 278 (T278I)
Ref Sequence ENSEMBL: ENSMUSP00000146906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084791] [ENSMUST00000207927]
Predicted Effect probably damaging
Transcript: ENSMUST00000084791
AA Change: T278I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081849
Gene: ENSMUSG00000066257
AA Change: T278I

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 6.2e-48 PFAM
Pfam:7TM_GPCR_Srsx 34 295 2.6e-5 PFAM
Pfam:7tm_1 40 289 3.7e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207927
AA Change: T278I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adamts20 C T 15: 94,403,445 R66H probably damaging Het
Anks1b A G 10: 90,049,892 E150G probably damaging Het
Chp2 A G 7: 122,220,918 D97G probably benign Het
Cnbd2 T C 2: 156,333,653 probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dusp15 A G 2: 152,944,182 L135P probably damaging Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Erlin2 G T 8: 27,025,099 V10L probably benign Het
F830104G03Rik A G 3: 56,890,213 S98P unknown Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Ighv1-22 G T 12: 114,746,663 A15E possibly damaging Het
Ints4 T C 7: 97,484,971 S37P probably damaging Het
Irs1 G A 1: 82,287,294 T1067I probably damaging Het
Lrrc28 C T 7: 67,531,614 probably null Het
Olfr1243 A G 2: 89,528,170 I80T possibly damaging Het
Olfr1420 A G 19: 11,896,558 Y179C probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Psma3 T C 12: 70,984,781 probably benign Het
Slc7a11 T C 3: 50,417,963 probably benign Het
Tas2r115 T C 6: 132,737,532 D152G probably damaging Het
Tti1 A T 2: 158,008,395 L308Q possibly damaging Het
Unc93b1 G A 19: 3,935,236 A15T probably benign Het
Usp43 G A 11: 67,856,407 R820C possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp286 C G 11: 62,780,204 G348R probably damaging Het
Zkscan5 T C 5: 145,211,174 probably benign Het
Other mutations in Olfr206
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01372:Olfr206 APN 16 59345161 missense probably damaging 0.97
IGL02106:Olfr206 APN 16 59345024 missense probably benign 0.00
IGL02839:Olfr206 APN 16 59345390 missense probably benign 0.01
IGL03010:Olfr206 APN 16 59344772 utr 3 prime probably benign
R1163:Olfr206 UTSW 16 59345062 missense probably damaging 0.99
R1507:Olfr206 UTSW 16 59345493 missense probably damaging 1.00
R1670:Olfr206 UTSW 16 59345427 missense possibly damaging 0.79
R2881:Olfr206 UTSW 16 59344852 missense probably damaging 1.00
R2925:Olfr206 UTSW 16 59345343 nonsense probably null
R4891:Olfr206 UTSW 16 59345471 missense possibly damaging 0.87
R5085:Olfr206 UTSW 16 59345086 missense probably damaging 0.99
R5099:Olfr206 UTSW 16 59344903 missense probably benign 0.00
R5218:Olfr206 UTSW 16 59344907 missense probably benign
R6019:Olfr206 UTSW 16 59345435 missense possibly damaging 0.48
R6773:Olfr206 UTSW 16 59345216 missense probably damaging 1.00
R7068:Olfr206 UTSW 16 59345204 missense possibly damaging 0.94
R7173:Olfr206 UTSW 16 59345147 missense probably benign 0.00
R7192:Olfr206 UTSW 16 59345179 missense probably benign 0.44
R7485:Olfr206 UTSW 16 59345324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGATTAGATCTTAAGGCCTTTG -3'
(R):5'- TTGCTGTCCTGAACATGAAGTC -3'

Sequencing Primer
(F):5'- TGTACAATTATGGGCAATATACAGG -3'
(R):5'- CTGTCCTGAACATGAAGTCTGAGAG -3'
Posted On2015-07-21