Mutagenetix > Incidental Mutation

Incidental Mutation 'R4479:Unc93b1'

331414

Institutional Source

Beutler Lab

Gene Symbol

Unc93b1

Ensembl Gene

ENSMUSG00000036908

Gene Name

unc-93 homolog B1 (C. elegans)

Synonyms

unc-93 homolog B, unc-93 related protein

MMRRC Submission

041736-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4479 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3935186-3949340 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 3935236 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 15 (A15T)

Ref Sequence

ENSEMBL: ENSMUSP00000128751 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000162708] [ENSMUST00000165711]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162193

Predicted Effect

unknown
Transcript: ENSMUST00000162708
AA Change: A15T

SMART Domains

Protein: ENSMUSP00000124272
Gene: ENSMUSG00000036908
AA Change: A15T

Domain	Start	End	E-Value	Type
low complexity region	66	78	N/A	INTRINSIC
transmembrane domain	81	103	N/A	INTRINSIC
Pfam:UNC-93	135	214	1.6e-8	PFAM
transmembrane domain	238	260	N/A	INTRINSIC
transmembrane domain	306	328	N/A	INTRINSIC
transmembrane domain	364	386	N/A	INTRINSIC
transmembrane domain	396	418	N/A	INTRINSIC
transmembrane domain	423	445	N/A	INTRINSIC
transmembrane domain	460	482	N/A	INTRINSIC
transmembrane domain	494	513	N/A	INTRINSIC
transmembrane domain	518	535	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165711
AA Change: A15T

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000128751
Gene: ENSMUSG00000036908
AA Change: A15T

Domain	Start	End	E-Value	Type
low complexity region	66	78	N/A	INTRINSIC
transmembrane domain	81	103	N/A	INTRINSIC
Pfam:UNC-93	135	214	5.1e-9	PFAM
transmembrane domain	243	265	N/A	INTRINSIC
transmembrane domain	305	327	N/A	INTRINSIC
transmembrane domain	367	389	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

95% (36/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in innate and adaptive immune response by regulating toll-like receptor signaling. The encoded protein traffics nucleotide sensing toll-like receptors to the endolysosome from the endoplasmic reticulum. Deficiency of the encoded protein has been associated with herpes simplex encephalitis. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice with a transmembrane domain point mutation have no overt phenotype but fail to mount a normal cytokine response and exhibit increased susceptibility to mouse cytomegalovirus, Lysteria monocytogenes and Staphlococcus aureus. Antigen presentation by MHC class I and II is impaired. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc6	T	C	7: 46,005,239	T553A	possibly damaging	Het
Adamts20	C	T	15: 94,403,445	R66H	probably damaging	Het
Anks1b	A	G	10: 90,049,892	E150G	probably damaging	Het
Chp2	A	G	7: 122,220,918	D97G	probably benign	Het
Cnbd2	T	C	2: 156,333,653		probably benign	Het
D130040H23Rik	C	A	8: 69,302,503	H187N	possibly damaging	Het
Dusp15	A	G	2: 152,944,182	L135P	probably damaging	Het
Eif4g1	G	T	16: 20,678,843		probably benign	Het
Erlin2	G	T	8: 27,025,099	V10L	probably benign	Het
F830104G03Rik	A	G	3: 56,890,213	S98P	unknown	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Gm3159	T	C	14: 4,398,584	Y92H	probably damaging	Het
Ighv1-22	G	T	12: 114,746,663	A15E	possibly damaging	Het
Ints4	T	C	7: 97,484,971	S37P	probably damaging	Het
Irs1	G	A	1: 82,287,294	T1067I	probably damaging	Het
Lrrc28	C	T	7: 67,531,614		probably null	Het
Olfr1243	A	G	2: 89,528,170	I80T	possibly damaging	Het
Olfr1420	A	G	19: 11,896,558	Y179C	probably damaging	Het
Olfr206	G	A	16: 59,344,867	T278I	probably damaging	Het
Psg18	C	T	7: 18,350,862	S103N	probably benign	Het
Psma3	T	C	12: 70,984,781		probably benign	Het
Slc7a11	T	C	3: 50,417,963		probably benign	Het
Tas2r115	T	C	6: 132,737,532	D152G	probably damaging	Het
Tti1	A	T	2: 158,008,395	L308Q	possibly damaging	Het
Usp43	G	A	11: 67,856,407	R820C	possibly damaging	Het
Vmn2r68	TCC	TC	7: 85,221,550		probably null	Het
Vps8	A	T	16: 21,545,236		probably benign	Het
Wdr73	T	C	7: 80,893,221	E213G	probably benign	Het
Zfp286	C	G	11: 62,780,204	G348R	probably damaging	Het
Zkscan5	T	C	5: 145,211,174		probably benign	Het

Other mutations in Unc93b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01088:Unc93b1	APN	19	3935356	splice site	probably null
IGL02631:Unc93b1	APN	19	3942026	splice site	probably benign
IGL02942:Unc93b1	APN	19	3948686	missense	probably damaging	1.00
IGL03149:Unc93b1	APN	19	3944041	missense	probably benign
3d	UTSW	19	3944168	missense	possibly damaging	0.96
novelty	UTSW	19	3943632	missense	probably damaging	1.00
speciality	UTSW	19	3941910	missense	possibly damaging	0.51
R0680:Unc93b1	UTSW	19	3947093	missense	probably benign
R1237:Unc93b1	UTSW	19	3935228	missense	possibly damaging	0.72
R1557:Unc93b1	UTSW	19	3942403	missense	probably benign	0.13
R1992:Unc93b1	UTSW	19	3944062	missense	probably benign	0.00
R2435:Unc93b1	UTSW	19	3936373	missense	possibly damaging	0.89
R4016:Unc93b1	UTSW	19	3943572	missense	probably damaging	1.00
R4080:Unc93b1	UTSW	19	3941959	missense	probably damaging	0.99
R4829:Unc93b1	UTSW	19	3944293	missense	probably damaging	1.00
R4947:Unc93b1	UTSW	19	3935871	missense	probably benign	0.05
R4964:Unc93b1	UTSW	19	3942023	splice site	probably null
R4966:Unc93b1	UTSW	19	3942023	splice site	probably null
R5056:Unc93b1	UTSW	19	3942762	missense	possibly damaging	0.45
R5166:Unc93b1	UTSW	19	3944027	missense	probably damaging	1.00
R5441:Unc93b1	UTSW	19	3943703	missense	probably benign	0.01
R5892:Unc93b1	UTSW	19	3943632	missense	probably damaging	1.00
R6382:Unc93b1	UTSW	19	3935297	missense	probably benign	0.19
R6556:Unc93b1	UTSW	19	3944105	missense	probably benign
R6962:Unc93b1	UTSW	19	3936303	missense	possibly damaging	0.57
R7143:Unc93b1	UTSW	19	3935204	missense	unknown
R7748:Unc93b1	UTSW	19	3935250	missense	unknown
R7866:Unc93b1	UTSW	19	3935243	missense	not run
R8198:Unc93b1	UTSW	19	3941910	missense	possibly damaging	0.51
R9212:Unc93b1	UTSW	19	3943557	missense	probably damaging	1.00
R9503:Unc93b1	UTSW	19	3936373	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- AAAAGCCCACCTTCTGCTT -3'
(R):5'- CCATCCCAGGGACCTTCC -3'

Sequencing Primer
(F):5'- CTGGTCTACAAAGTGAGCTCCAG -3'
(R):5'- CCATCAGGAACTCCGTG -3'

Posted On

2015-07-21