Incidental Mutation 'R4479:Unc93b1'
ID331414
Institutional Source Beutler Lab
Gene Symbol Unc93b1
Ensembl Gene ENSMUSG00000036908
Gene Nameunc-93 homolog B1 (C. elegans)
Synonymsunc-93 homolog B, unc-93 related protein
MMRRC Submission 041736-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4479 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location3935186-3949340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3935236 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 15 (A15T)
Ref Sequence ENSEMBL: ENSMUSP00000128751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162708] [ENSMUST00000165711]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162193
Predicted Effect unknown
Transcript: ENSMUST00000162708
AA Change: A15T
SMART Domains Protein: ENSMUSP00000124272
Gene: ENSMUSG00000036908
AA Change: A15T

DomainStartEndE-ValueType
low complexity region 66 78 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
Pfam:UNC-93 135 214 1.6e-8 PFAM
transmembrane domain 238 260 N/A INTRINSIC
transmembrane domain 306 328 N/A INTRINSIC
transmembrane domain 364 386 N/A INTRINSIC
transmembrane domain 396 418 N/A INTRINSIC
transmembrane domain 423 445 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
transmembrane domain 494 513 N/A INTRINSIC
transmembrane domain 518 535 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165711
AA Change: A15T

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000128751
Gene: ENSMUSG00000036908
AA Change: A15T

DomainStartEndE-ValueType
low complexity region 66 78 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
Pfam:UNC-93 135 214 5.1e-9 PFAM
transmembrane domain 243 265 N/A INTRINSIC
transmembrane domain 305 327 N/A INTRINSIC
transmembrane domain 367 389 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in innate and adaptive immune response by regulating toll-like receptor signaling. The encoded protein traffics nucleotide sensing toll-like receptors to the endolysosome from the endoplasmic reticulum. Deficiency of the encoded protein has been associated with herpes simplex encephalitis. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice with a transmembrane domain point mutation have no overt phenotype but fail to mount a normal cytokine response and exhibit increased susceptibility to mouse cytomegalovirus, Lysteria monocytogenes and Staphlococcus aureus. Antigen presentation by MHC class I and II is impaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adamts20 C T 15: 94,403,445 R66H probably damaging Het
Anks1b A G 10: 90,049,892 E150G probably damaging Het
Chp2 A G 7: 122,220,918 D97G probably benign Het
Cnbd2 T C 2: 156,333,653 probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dusp15 A G 2: 152,944,182 L135P probably damaging Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Erlin2 G T 8: 27,025,099 V10L probably benign Het
F830104G03Rik A G 3: 56,890,213 S98P unknown Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Ighv1-22 G T 12: 114,746,663 A15E possibly damaging Het
Ints4 T C 7: 97,484,971 S37P probably damaging Het
Irs1 G A 1: 82,287,294 T1067I probably damaging Het
Lrrc28 C T 7: 67,531,614 probably null Het
Olfr1243 A G 2: 89,528,170 I80T possibly damaging Het
Olfr1420 A G 19: 11,896,558 Y179C probably damaging Het
Olfr206 G A 16: 59,344,867 T278I probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Psma3 T C 12: 70,984,781 probably benign Het
Slc7a11 T C 3: 50,417,963 probably benign Het
Tas2r115 T C 6: 132,737,532 D152G probably damaging Het
Tti1 A T 2: 158,008,395 L308Q possibly damaging Het
Usp43 G A 11: 67,856,407 R820C possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp286 C G 11: 62,780,204 G348R probably damaging Het
Zkscan5 T C 5: 145,211,174 probably benign Het
Other mutations in Unc93b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Unc93b1 APN 19 3935356 splice site probably null
IGL02631:Unc93b1 APN 19 3942026 splice site probably benign
IGL02942:Unc93b1 APN 19 3948686 missense probably damaging 1.00
IGL03149:Unc93b1 APN 19 3944041 missense probably benign
3d UTSW 19 3944168 missense possibly damaging 0.96
R0680:Unc93b1 UTSW 19 3947093 missense probably benign
R1237:Unc93b1 UTSW 19 3935228 missense possibly damaging 0.72
R1557:Unc93b1 UTSW 19 3942403 missense probably benign 0.13
R1992:Unc93b1 UTSW 19 3944062 missense probably benign 0.00
R2435:Unc93b1 UTSW 19 3936373 missense possibly damaging 0.89
R4016:Unc93b1 UTSW 19 3943572 missense probably damaging 1.00
R4080:Unc93b1 UTSW 19 3941959 missense probably damaging 0.99
R4829:Unc93b1 UTSW 19 3944293 missense probably damaging 1.00
R4947:Unc93b1 UTSW 19 3935871 missense probably benign 0.05
R4964:Unc93b1 UTSW 19 3942023 splice site probably null
R4966:Unc93b1 UTSW 19 3942023 splice site probably null
R5056:Unc93b1 UTSW 19 3942762 missense possibly damaging 0.45
R5166:Unc93b1 UTSW 19 3944027 missense probably damaging 1.00
R5441:Unc93b1 UTSW 19 3943703 missense probably benign 0.01
R5892:Unc93b1 UTSW 19 3943632 missense probably damaging 1.00
R6382:Unc93b1 UTSW 19 3935297 missense probably benign 0.19
R6556:Unc93b1 UTSW 19 3944105 missense probably benign
R6962:Unc93b1 UTSW 19 3936303 missense possibly damaging 0.57
R7143:Unc93b1 UTSW 19 3935204 missense unknown
R7748:Unc93b1 UTSW 19 3935250 missense unknown
R7866:Unc93b1 UTSW 19 3935243 missense not run
R8198:Unc93b1 UTSW 19 3941910 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- AAAAGCCCACCTTCTGCTT -3'
(R):5'- CCATCCCAGGGACCTTCC -3'

Sequencing Primer
(F):5'- CTGGTCTACAAAGTGAGCTCCAG -3'
(R):5'- CCATCAGGAACTCCGTG -3'
Posted On2015-07-21