Incidental Mutation 'R4479:Olfr1420'
ID331415
Institutional Source Beutler Lab
Gene Symbol Olfr1420
Ensembl Gene ENSMUSG00000060878
Gene Nameolfactory receptor 1420
SynonymsMOR266-4, GA_x6K02T2RE5P-2247227-2248156
MMRRC Submission 041736-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R4479 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location11886565-11898079 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11896558 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 179 (Y179C)
Ref Sequence ENSEMBL: ENSMUSP00000149208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072784] [ENSMUST00000217281]
Predicted Effect probably damaging
Transcript: ENSMUST00000072784
AA Change: Y179C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000072563
Gene: ENSMUSG00000060878
AA Change: Y179C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.3e-54 PFAM
Pfam:7tm_1 41 291 3.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215766
Predicted Effect probably damaging
Transcript: ENSMUST00000217281
AA Change: Y179C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.1855 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adamts20 C T 15: 94,403,445 R66H probably damaging Het
Anks1b A G 10: 90,049,892 E150G probably damaging Het
Chp2 A G 7: 122,220,918 D97G probably benign Het
Cnbd2 T C 2: 156,333,653 probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dusp15 A G 2: 152,944,182 L135P probably damaging Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Erlin2 G T 8: 27,025,099 V10L probably benign Het
F830104G03Rik A G 3: 56,890,213 S98P unknown Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Ighv1-22 G T 12: 114,746,663 A15E possibly damaging Het
Ints4 T C 7: 97,484,971 S37P probably damaging Het
Irs1 G A 1: 82,287,294 T1067I probably damaging Het
Lrrc28 C T 7: 67,531,614 probably null Het
Olfr1243 A G 2: 89,528,170 I80T possibly damaging Het
Olfr206 G A 16: 59,344,867 T278I probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Psma3 T C 12: 70,984,781 probably benign Het
Slc7a11 T C 3: 50,417,963 probably benign Het
Tas2r115 T C 6: 132,737,532 D152G probably damaging Het
Tti1 A T 2: 158,008,395 L308Q possibly damaging Het
Unc93b1 G A 19: 3,935,236 A15T probably benign Het
Usp43 G A 11: 67,856,407 R820C possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp286 C G 11: 62,780,204 G348R probably damaging Het
Zkscan5 T C 5: 145,211,174 probably benign Het
Other mutations in Olfr1420
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02419:Olfr1420 APN 19 11896822 missense probably benign 0.06
IGL02703:Olfr1420 APN 19 11896242 missense possibly damaging 0.96
IGL02948:Olfr1420 APN 19 11896781 nonsense probably null
R1514:Olfr1420 UTSW 19 11896614 missense probably benign
R1539:Olfr1420 UTSW 19 11896491 missense possibly damaging 0.88
R1852:Olfr1420 UTSW 19 11896885 missense probably damaging 1.00
R1903:Olfr1420 UTSW 19 11896549 missense probably benign 0.24
R2061:Olfr1420 UTSW 19 11896557 missense probably damaging 0.98
R3768:Olfr1420 UTSW 19 11896312 missense probably damaging 0.99
R3977:Olfr1420 UTSW 19 11896516 missense probably damaging 1.00
R4592:Olfr1420 UTSW 19 11896762 missense probably benign
R5934:Olfr1420 UTSW 19 11896929 missense probably benign
R6058:Olfr1420 UTSW 19 11896024 start codon destroyed probably null 1.00
R6536:Olfr1420 UTSW 19 11896396 missense probably benign 0.05
R7752:Olfr1420 UTSW 19 11896534 missense probably benign 0.01
R7901:Olfr1420 UTSW 19 11896534 missense probably benign 0.01
R8250:Olfr1420 UTSW 19 11896377 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGACCGGTTTGTTGCGATC -3'
(R):5'- AGCCATACTGTAGGAGGACCAC -3'

Sequencing Primer
(F):5'- GATCTGCTACCCTCTGAGATACAC -3'
(R):5'- CATACTGTAGGAGGACCACTACGATG -3'
Posted On2015-07-21