Incidental Mutation 'R4480:Eif2s2'
ID331419
Institutional Source Beutler Lab
Gene Symbol Eif2s2
Ensembl Gene ENSMUSG00000074656
Gene Nameeukaryotic translation initiation factor 2, subunit 2 (beta)
Synonyms2810026E11Rik, D2Ertd303e, EIF2B, 38kDa, EIF2
MMRRC Submission 041737-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4480 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location154871410-154892935 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 154888270 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 36 (T36A)
Ref Sequence ENSEMBL: ENSMUSP00000128257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099173] [ENSMUST00000137333] [ENSMUST00000161172] [ENSMUST00000166171]
Predicted Effect probably benign
Transcript: ENSMUST00000099173
AA Change: T36A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096777
Gene: ENSMUSG00000074656
AA Change: T36A

DomainStartEndE-ValueType
low complexity region 40 55 N/A INTRINSIC
low complexity region 79 87 N/A INTRINSIC
low complexity region 123 132 N/A INTRINSIC
eIF2B_5 197 306 1.93e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135524
Predicted Effect probably benign
Transcript: ENSMUST00000137333
SMART Domains Protein: ENSMUSP00000122261
Gene: ENSMUSG00000027596

DomainStartEndE-ValueType
Agouti 6 70 2.53e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147136
Predicted Effect probably benign
Transcript: ENSMUST00000161172
AA Change: T31A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125248
Gene: ENSMUSG00000074656
AA Change: T31A

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 74 82 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166171
AA Change: T36A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128257
Gene: ENSMUSG00000074656
AA Change: T36A

DomainStartEndE-ValueType
low complexity region 40 55 N/A INTRINSIC
low complexity region 79 87 N/A INTRINSIC
low complexity region 123 132 N/A INTRINSIC
eIF2B_5 197 306 1.93e-68 SMART
Meta Mutation Damage Score 0.0577 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic translation initiation factor 2 (EIF-2) functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA and binding to a 40S ribosomal subunit. EIF-2 is composed of three subunits, alpha, beta, and gamma, with the protein encoded by this gene representing the beta subunit. The beta subunit catalyzes the exchange of GDP for GTP, which recycles the EIF-2 complex for another round of initiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethallity prior to E8.5. Mice heterozygous for a gene trap allele exhibit reduced incidence of testicular germ cell tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adgrb3 A T 1: 25,111,748 F1135I probably damaging Het
Arfgef3 A T 10: 18,600,600 F1490L probably damaging Het
Begain A G 12: 109,034,123 Y446H probably damaging Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dip2b C T 15: 100,186,301 T935M probably damaging Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbxo10 T C 4: 45,048,470 Y555C probably damaging Het
Fpr2 C T 17: 17,893,753 T337I probably benign Het
Frem3 A T 8: 80,611,357 Q93L probably benign Het
Gapdh A G 6: 125,163,182 V119A possibly damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Hkdc1 T C 10: 62,391,372 I769V probably benign Het
Ifne T C 4: 88,879,601 *193W probably null Het
Katna1 T C 10: 7,738,830 V32A probably damaging Het
Nup107 T C 10: 117,761,332 I673V probably benign Het
Nup188 T A 2: 30,322,129 probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1510 G A 14: 52,410,308 A188V probably damaging Het
Olfr330 G T 11: 58,529,801 P62T probably damaging Het
Pcdhb5 T A 18: 37,320,752 S62T probably benign Het
Plekha5 T C 6: 140,526,479 V44A probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Ptprcap A G 19: 4,156,224 E102G probably benign Het
Ptprs A G 17: 56,426,404 V804A possibly damaging Het
Rab35 C A 5: 115,637,764 S34* probably null Het
Slco6d1 T A 1: 98,507,574 Y671* probably null Het
Sostdc1 A G 12: 36,317,166 I114V probably damaging Het
Tecta A G 9: 42,373,233 F852S possibly damaging Het
Tmem179 T C 12: 112,503,303 E21G probably benign Het
Tmem2 A G 19: 21,815,489 Q703R probably benign Het
Usp17la T A 7: 104,860,690 H167Q probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr17 A G 8: 54,664,964 probably null Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp985 A G 4: 147,584,079 D468G probably benign Het
Other mutations in Eif2s2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Eif2s2 APN 2 154887709 missense probably benign
R0414:Eif2s2 UTSW 2 154884461 splice site probably benign
R0631:Eif2s2 UTSW 2 154884358 missense probably damaging 0.99
R4660:Eif2s2 UTSW 2 154888269 missense probably benign 0.17
R4735:Eif2s2 UTSW 2 154878547 intron probably null
R5054:Eif2s2 UTSW 2 154892670 intron probably null
R8062:Eif2s2 UTSW 2 154877804 missense possibly damaging 0.82
R8163:Eif2s2 UTSW 2 154892701 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATCCCTCGATGTACGGCTC -3'
(R):5'- AAGTGTGGGATGTCTCCAGC -3'

Sequencing Primer
(F):5'- TCGATGTACGGCTCCAGGTC -3'
(R):5'- AGCCCCACCTTTTGGCATTTTAATG -3'
Posted On2015-07-21