Incidental Mutation 'R4480:Wdr73'
ID 331427
Institutional Source Beutler Lab
Gene Symbol Wdr73
Ensembl Gene ENSMUSG00000025722
Gene Name WD repeat domain 73
Synonyms 2410008B13Rik, 1200011I23Rik
MMRRC Submission 041737-MU
Accession Numbers

Genbank: NM_028026; MGI: 1919218

Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock # R4480 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 80890723-80901269 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80893221 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 213 (E213G)
Ref Sequence ENSEMBL: ENSMUSP00000026816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026816]
AlphaFold Q9CWR1
Predicted Effect probably benign
Transcript: ENSMUST00000026816
AA Change: E213G

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000026816
Gene: ENSMUSG00000025722
AA Change: E213G

DomainStartEndE-ValueType
WD40 67 112 8.52e1 SMART
Blast:WD40 162 204 3e-6 BLAST
Blast:WD40 208 254 3e-17 BLAST
WD40 263 304 2.57e0 SMART
WD40 314 364 8.91e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139990
Predicted Effect unknown
Transcript: ENSMUST00000146402
AA Change: E186G
SMART Domains Protein: ENSMUSP00000119974
Gene: ENSMUSG00000025722
AA Change: E186G

DomainStartEndE-ValueType
Blast:WD40 66 111 3e-26 BLAST
Blast:WD40 182 228 4e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152518
Meta Mutation Damage Score 0.2193 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain multiple WD40 repeats. WD40 repeats are motifs that contain 40-60 amino acids, and usually end with Trp-Asp (WD). This protein is found in the cytoplasm during interphase, but accumulates at the spindle poles and astral microtubules during mitosis. Reduced expression of this gene results in abnormalities in the size and morphology of the nucleus. Mutations in this gene have been associated with Galloway-Mowat syndrome PMID: 25466283), which is a rare autosomal recessive disorder that affects both the central nervous system and kidneys. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adgrb3 A T 1: 25,111,748 F1135I probably damaging Het
Arfgef3 A T 10: 18,600,600 F1490L probably damaging Het
Begain A G 12: 109,034,123 Y446H probably damaging Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dip2b C T 15: 100,186,301 T935M probably damaging Het
Eif2s2 T C 2: 154,888,270 T36A probably benign Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbxo10 T C 4: 45,048,470 Y555C probably damaging Het
Fpr2 C T 17: 17,893,753 T337I probably benign Het
Frem3 A T 8: 80,611,357 Q93L probably benign Het
Gapdh A G 6: 125,163,182 V119A possibly damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Hkdc1 T C 10: 62,391,372 I769V probably benign Het
Ifne T C 4: 88,879,601 *193W probably null Het
Katna1 T C 10: 7,738,830 V32A probably damaging Het
Nup107 T C 10: 117,761,332 I673V probably benign Het
Nup188 T A 2: 30,322,129 probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1510 G A 14: 52,410,308 A188V probably damaging Het
Olfr330 G T 11: 58,529,801 P62T probably damaging Het
Pcdhb5 T A 18: 37,320,752 S62T probably benign Het
Plekha5 T C 6: 140,526,479 V44A probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Ptprcap A G 19: 4,156,224 E102G probably benign Het
Ptprs A G 17: 56,426,404 V804A possibly damaging Het
Rab35 C A 5: 115,637,764 S34* probably null Het
Slco6d1 T A 1: 98,507,574 Y671* probably null Het
Sostdc1 A G 12: 36,317,166 I114V probably damaging Het
Tecta A G 9: 42,373,233 F852S possibly damaging Het
Tmem179 T C 12: 112,503,303 E21G probably benign Het
Tmem2 A G 19: 21,815,489 Q703R probably benign Het
Usp17la T A 7: 104,860,690 H167Q probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr17 A G 8: 54,664,964 probably null Het
Zfp985 A G 4: 147,584,079 D468G probably benign Het
Other mutations in Wdr73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Wdr73 APN 7 80893663 missense probably benign 0.01
IGL02183:Wdr73 APN 7 80893760 missense probably damaging 1.00
IGL03253:Wdr73 APN 7 80897946 missense probably benign 0.00
3-1:Wdr73 UTSW 7 80897959 missense possibly damaging 0.91
R0469:Wdr73 UTSW 7 80897950 nonsense probably null
R0507:Wdr73 UTSW 7 80891846 missense possibly damaging 0.88
R0510:Wdr73 UTSW 7 80897950 nonsense probably null
R1349:Wdr73 UTSW 7 80893252 missense probably damaging 1.00
R1782:Wdr73 UTSW 7 80891778 missense probably damaging 1.00
R1917:Wdr73 UTSW 7 80893333 missense probably benign 0.17
R3085:Wdr73 UTSW 7 80901242 unclassified probably benign
R4478:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4479:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4910:Wdr73 UTSW 7 80891708 missense probably damaging 0.97
R4925:Wdr73 UTSW 7 80893195 missense probably benign 0.00
R5046:Wdr73 UTSW 7 80892425 unclassified probably benign
R5286:Wdr73 UTSW 7 80891809 missense probably benign 0.04
R5842:Wdr73 UTSW 7 80891710 missense probably damaging 1.00
R6991:Wdr73 UTSW 7 80891856 missense probably benign 0.17
R7182:Wdr73 UTSW 7 80893678 missense possibly damaging 0.45
R7197:Wdr73 UTSW 7 80893198 missense probably benign 0.02
R7362:Wdr73 UTSW 7 80900703 missense probably damaging 1.00
R7771:Wdr73 UTSW 7 80893227 missense probably benign 0.13
R8558:Wdr73 UTSW 7 80898506 missense probably damaging 1.00
R8950:Wdr73 UTSW 7 80900383 missense probably benign 0.00
X0022:Wdr73 UTSW 7 80897951 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TTTGAACACCGGACACTGG -3'
(R):5'- CTCAGGGTTTCTGTGCCAGATG -3'

Sequencing Primer
(F):5'- GGCTGAGCTCACAGGATGAC -3'
(R):5'- CACCAGCAGAGCAGACTGG -3'
Posted On 2015-07-21