Incidental Mutation 'R4480:Usp17la'
ID331428
Institutional Source Beutler Lab
Gene Symbol Usp17la
Ensembl Gene ENSMUSG00000054568
Gene Nameubiquitin specific peptidase 17-like A
Synonyms
MMRRC Submission 041737-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R4480 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104857009-104862667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104860690 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 167 (H167Q)
Ref Sequence ENSEMBL: ENSMUSP00000068997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067695]
Predicted Effect probably benign
Transcript: ENSMUST00000067695
AA Change: H167Q

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000068997
Gene: ENSMUSG00000054568
AA Change: H167Q

DomainStartEndE-ValueType
Pfam:UCH 50 345 3.3e-53 PFAM
Pfam:UCH_1 51 328 1.1e-24 PFAM
low complexity region 374 385 N/A INTRINSIC
low complexity region 505 521 N/A INTRINSIC
Meta Mutation Damage Score 0.0972 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adgrb3 A T 1: 25,111,748 F1135I probably damaging Het
Arfgef3 A T 10: 18,600,600 F1490L probably damaging Het
Begain A G 12: 109,034,123 Y446H probably damaging Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dip2b C T 15: 100,186,301 T935M probably damaging Het
Eif2s2 T C 2: 154,888,270 T36A probably benign Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbxo10 T C 4: 45,048,470 Y555C probably damaging Het
Fpr2 C T 17: 17,893,753 T337I probably benign Het
Frem3 A T 8: 80,611,357 Q93L probably benign Het
Gapdh A G 6: 125,163,182 V119A possibly damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Hkdc1 T C 10: 62,391,372 I769V probably benign Het
Ifne T C 4: 88,879,601 *193W probably null Het
Katna1 T C 10: 7,738,830 V32A probably damaging Het
Nup107 T C 10: 117,761,332 I673V probably benign Het
Nup188 T A 2: 30,322,129 probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1510 G A 14: 52,410,308 A188V probably damaging Het
Olfr330 G T 11: 58,529,801 P62T probably damaging Het
Pcdhb5 T A 18: 37,320,752 S62T probably benign Het
Plekha5 T C 6: 140,526,479 V44A probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Ptprcap A G 19: 4,156,224 E102G probably benign Het
Ptprs A G 17: 56,426,404 V804A possibly damaging Het
Rab35 C A 5: 115,637,764 S34* probably null Het
Slco6d1 T A 1: 98,507,574 Y671* probably null Het
Sostdc1 A G 12: 36,317,166 I114V probably damaging Het
Tecta A G 9: 42,373,233 F852S possibly damaging Het
Tmem179 T C 12: 112,503,303 E21G probably benign Het
Tmem2 A G 19: 21,815,489 Q703R probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr17 A G 8: 54,664,964 probably null Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp985 A G 4: 147,584,079 D468G probably benign Het
Other mutations in Usp17la
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Usp17la APN 7 104861315 missense probably benign 0.04
IGL01482:Usp17la APN 7 104859393 start codon destroyed probably benign 0.28
IGL02236:Usp17la APN 7 104861146 nonsense probably null
IGL03239:Usp17la APN 7 104860620 missense possibly damaging 0.69
R0512:Usp17la UTSW 7 104861039 missense possibly damaging 0.50
R1632:Usp17la UTSW 7 104860911 missense probably benign 0.02
R1828:Usp17la UTSW 7 104861124 missense probably damaging 1.00
R1918:Usp17la UTSW 7 104860746 missense probably benign 0.11
R1976:Usp17la UTSW 7 104860320 missense possibly damaging 0.81
R2058:Usp17la UTSW 7 104861171 missense probably damaging 1.00
R2059:Usp17la UTSW 7 104861171 missense probably damaging 1.00
R2078:Usp17la UTSW 7 104859393 start codon destroyed probably benign 0.28
R2197:Usp17la UTSW 7 104860712 missense probably damaging 1.00
R3610:Usp17la UTSW 7 104861072 missense probably damaging 1.00
R3684:Usp17la UTSW 7 104861730 missense possibly damaging 0.96
R4633:Usp17la UTSW 7 104860221 missense possibly damaging 0.92
R4701:Usp17la UTSW 7 104860649 nonsense probably null
R4907:Usp17la UTSW 7 104861148 missense probably damaging 1.00
R5057:Usp17la UTSW 7 104861123 missense possibly damaging 0.95
R5091:Usp17la UTSW 7 104860932 missense probably damaging 0.99
R5313:Usp17la UTSW 7 104861250 missense probably benign 0.00
R6269:Usp17la UTSW 7 104860350 missense possibly damaging 0.82
R7054:Usp17la UTSW 7 104861307 missense probably benign 0.38
R7395:Usp17la UTSW 7 104861585 missense probably benign 0.30
R7570:Usp17la UTSW 7 104860397 missense probably damaging 1.00
X0062:Usp17la UTSW 7 104861478 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAGTCTCCTGCACTCTCAC -3'
(R):5'- CTTAGAAGCTGGCATCTTCTGTC -3'

Sequencing Primer
(F):5'- CTCACTCGGGGGATGTCATGAAG -3'
(R):5'- CTGTCTACACTTACCACAGTAGTAGG -3'
Posted On2015-07-21