Mutagenetix > Incidental Mutation

Incidental Mutation 'R4480:Cdh15'

331431

Institutional Source

Beutler Lab

Gene Symbol

Cdh15

Ensembl Gene

ENSMUSG00000031962

Gene Name

cadherin 15

Synonyms

M cadherin, Mcad, Cdh14

MMRRC Submission

041737-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4480 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123575113-123594136 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 123591415 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 517 (H517R)

Ref Sequence

ENSEMBL: ENSMUSP00000034443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034443] [ENSMUST00000127664]

AlphaFold

P33146

Predicted Effect

probably benign
Transcript: ENSMUST00000034443
AA Change: H517R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000034443
Gene: ENSMUSG00000031962
AA Change: H517R

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CA	64	149	5.95e-18	SMART
CA	173	257	3.09e-25	SMART
CA	280	373	2.5e-11	SMART
CA	396	480	3.45e-14	SMART
Pfam:Cadherin	486	579	5.2e-9	PFAM
transmembrane domain	603	625	N/A	INTRINSIC
Pfam:Cadherin_C	633	783	6.7e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Meta Mutation Damage Score

0.0582

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

95% (40/42)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Based on the expression of this gene in skeletal muscle, satellite cells and cerebellum, it was postulated that the encoded protein may be important for muscle development and regeneration. Mice lacking the encoded protein appear normal and display no discernible defects in skeletal musculature. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no apparent defects in the development, maintenance, or regeneration of skeletal muscle or in the cerebellum. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc6	T	C	7: 45,654,663 (GRCm39)	T553A	possibly damaging	Het
Adgrb3	A	T	1: 25,150,829 (GRCm39)	F1135I	probably damaging	Het
Arfgef3	A	T	10: 18,476,348 (GRCm39)	F1490L	probably damaging	Het
Begain	A	G	12: 109,000,049 (GRCm39)	Y446H	probably damaging	Het
Cemip2	A	G	19: 21,792,853 (GRCm39)	Q703R	probably benign	Het
D130040H23Rik	C	A	8: 69,755,155 (GRCm39)	H187N	possibly damaging	Het
Dip2b	C	T	15: 100,084,182 (GRCm39)	T935M	probably damaging	Het
Eif2s2	T	C	2: 154,730,190 (GRCm39)	T36A	probably benign	Het
Eif4g1	G	T	16: 20,497,593 (GRCm39)		probably benign	Het
Fat3	G	A	9: 15,909,567 (GRCm39)	S2145F	probably damaging	Het
Fbxo10	T	C	4: 45,048,470 (GRCm39)	Y555C	probably damaging	Het
Fpr2	C	T	17: 18,114,015 (GRCm39)	T337I	probably benign	Het
Frem3	A	T	8: 81,337,986 (GRCm39)	Q93L	probably benign	Het
Gapdh	A	G	6: 125,140,145 (GRCm39)	V119A	possibly damaging	Het
Gm3159	T	C	14: 4,398,584 (GRCm38)	Y92H	probably damaging	Het
Hkdc1	T	C	10: 62,227,151 (GRCm39)	I769V	probably benign	Het
Ifne	T	C	4: 88,797,838 (GRCm39)	*193W	probably null	Het
Katna1	T	C	10: 7,614,594 (GRCm39)	V32A	probably damaging	Het
Nup107	T	C	10: 117,597,237 (GRCm39)	I673V	probably benign	Het
Nup188	T	A	2: 30,212,141 (GRCm39)		probably benign	Het
Obscn	T	C	11: 59,022,472 (GRCm39)	R758G	possibly damaging	Het
Or10g1	G	A	14: 52,647,765 (GRCm39)	A188V	probably damaging	Het
Or2t48	G	T	11: 58,420,627 (GRCm39)	P62T	probably damaging	Het
Pcdhb5	T	A	18: 37,453,805 (GRCm39)	S62T	probably benign	Het
Plekha5	T	C	6: 140,472,205 (GRCm39)	V44A	probably damaging	Het
Psg18	C	T	7: 18,084,787 (GRCm39)	S103N	probably benign	Het
Ptprcap	A	G	19: 4,206,223 (GRCm39)	E102G	probably benign	Het
Ptprs	A	G	17: 56,733,404 (GRCm39)	V804A	possibly damaging	Het
Rab35	C	A	5: 115,775,823 (GRCm39)	S34*	probably null	Het
Slco6d1	T	A	1: 98,435,299 (GRCm39)	Y671*	probably null	Het
Sostdc1	A	G	12: 36,367,165 (GRCm39)	I114V	probably damaging	Het
Tecta	A	G	9: 42,284,529 (GRCm39)	F852S	possibly damaging	Het
Tmem179	T	C	12: 112,469,737 (GRCm39)	E21G	probably benign	Het
Usp17la	T	A	7: 104,509,897 (GRCm39)	H167Q	probably benign	Het
Vps8	A	T	16: 21,363,986 (GRCm39)		probably benign	Het
Wdr17	A	G	8: 55,117,999 (GRCm39)		probably null	Het
Wdr73	T	C	7: 80,542,969 (GRCm39)	E213G	probably benign	Het
Zfp985	A	G	4: 147,668,536 (GRCm39)	D468G	probably benign	Het

Other mutations in Cdh15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Cdh15	APN	8	123,592,062 (GRCm39)	intron	probably benign
IGL01958:Cdh15	APN	8	123,586,089 (GRCm39)	missense	probably damaging	1.00
IGL02588:Cdh15	APN	8	123,583,291 (GRCm39)	nonsense	probably null
IGL02793:Cdh15	APN	8	123,587,721 (GRCm39)	missense	probably damaging	1.00
IGL02947:Cdh15	APN	8	123,592,111 (GRCm39)	missense	probably benign	0.00
R0310:Cdh15	UTSW	8	123,592,175 (GRCm39)	missense	probably damaging	1.00
R0441:Cdh15	UTSW	8	123,587,705 (GRCm39)	missense	probably damaging	1.00
R0766:Cdh15	UTSW	8	123,588,188 (GRCm39)	intron	probably benign
R0898:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1023:Cdh15	UTSW	8	123,591,939 (GRCm39)	missense	probably damaging	0.98
R1054:Cdh15	UTSW	8	123,591,076 (GRCm39)	missense	possibly damaging	0.85
R1072:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R1081:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1101:Cdh15	UTSW	8	123,587,585 (GRCm39)	missense	possibly damaging	0.93
R1208:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1208:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1209:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1210:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1312:Cdh15	UTSW	8	123,588,188 (GRCm39)	intron	probably benign
R1317:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1318:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1393:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1428:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1429:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1695:Cdh15	UTSW	8	123,588,755 (GRCm39)	missense	probably benign	0.05
R2157:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2170:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2178:Cdh15	UTSW	8	123,591,715 (GRCm39)	splice site	probably null
R2252:Cdh15	UTSW	8	123,584,161 (GRCm39)	missense	probably damaging	1.00
R2290:Cdh15	UTSW	8	123,586,056 (GRCm39)	missense	probably damaging	1.00
R2317:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2330:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2345:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2349:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2353:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2354:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2566:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2567:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2568:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2893:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2894:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2937:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2938:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2990:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2992:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2993:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3029:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3030:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3195:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R3441:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3442:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3608:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3686:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R4119:Cdh15	UTSW	8	123,590,162 (GRCm39)	missense	probably damaging	1.00
R4120:Cdh15	UTSW	8	123,590,162 (GRCm39)	missense	probably damaging	1.00
R4477:Cdh15	UTSW	8	123,591,415 (GRCm39)	missense	probably benign	0.00
R4478:Cdh15	UTSW	8	123,591,415 (GRCm39)	missense	probably benign	0.00
R4580:Cdh15	UTSW	8	123,591,897 (GRCm39)	missense	probably damaging	0.99
R4583:Cdh15	UTSW	8	123,591,767 (GRCm39)	missense	probably damaging	0.98
R4619:Cdh15	UTSW	8	123,587,612 (GRCm39)	missense	probably damaging	1.00
R4694:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R4731:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R5076:Cdh15	UTSW	8	123,591,087 (GRCm39)	missense	possibly damaging	0.82
R5347:Cdh15	UTSW	8	123,588,802 (GRCm39)	missense	probably null	1.00
R5375:Cdh15	UTSW	8	123,591,839 (GRCm39)	missense	probably damaging	1.00
R5498:Cdh15	UTSW	8	123,591,917 (GRCm39)	missense	possibly damaging	0.79
R5778:Cdh15	UTSW	8	123,583,326 (GRCm39)	missense	possibly damaging	0.80
R6320:Cdh15	UTSW	8	123,591,086 (GRCm39)	missense	probably benign	0.01
R6570:Cdh15	UTSW	8	123,584,130 (GRCm39)	missense	probably damaging	1.00
R6708:Cdh15	UTSW	8	123,590,294 (GRCm39)	missense	probably benign	0.32
R7505:Cdh15	UTSW	8	123,575,231 (GRCm39)	missense	probably benign	0.01
R7527:Cdh15	UTSW	8	123,588,865 (GRCm39)	missense	probably damaging	1.00
R7724:Cdh15	UTSW	8	123,593,700 (GRCm39)	missense	probably damaging	1.00
R8093:Cdh15	UTSW	8	123,593,574 (GRCm39)	missense	probably damaging	1.00
R8485:Cdh15	UTSW	8	123,584,105 (GRCm39)	missense	probably damaging	1.00
R8759:Cdh15	UTSW	8	123,587,628 (GRCm39)	missense	probably damaging	1.00
R8910:Cdh15	UTSW	8	123,575,240 (GRCm39)	missense	probably benign	0.04
R9017:Cdh15	UTSW	8	123,584,256 (GRCm39)	critical splice donor site	probably null
R9453:Cdh15	UTSW	8	123,586,029 (GRCm39)	missense	probably damaging	0.99
R9699:Cdh15	UTSW	8	123,588,769 (GRCm39)	missense	probably benign	0.00
R9705:Cdh15	UTSW	8	123,591,024 (GRCm39)	missense	probably damaging	1.00
Z1176:Cdh15	UTSW	8	123,590,998 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCATTCCTCCTAGCACAG -3'
(R):5'- CTACCCATTGGATACTGTGGAAAC -3'

Sequencing Primer
(F):5'- TTCCTCCTAGCACAGCCACAG -3'
(R):5'- CCCATTGGATACTGTGGAAACGAATC -3'

Posted On

2015-07-21