Incidental Mutation 'R4480:Katna1'
ID331434
Institutional Source Beutler Lab
Gene Symbol Katna1
Ensembl Gene ENSMUSG00000019794
Gene Namekatanin p60 (ATPase-containing) subunit A1
Synonyms
MMRRC Submission 041737-MU
Accession Numbers

Ncbi RefSeq: NM_011835.2; MGI:1344353

Is this an essential gene? Possibly essential (E-score: 0.703) question?
Stock #R4480 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location7726000-7763150 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7738830 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 32 (V32A)
Ref Sequence ENSEMBL: ENSMUSP00000133588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019929] [ENSMUST00000165806] [ENSMUST00000173400]
Predicted Effect probably benign
Transcript: ENSMUST00000019929
AA Change: V32A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000019929
Gene: ENSMUSG00000019794
AA Change: V32A

DomainStartEndE-ValueType
PDB:2RPA|A 1 72 2e-44 PDB
AAA 241 383 5.2e-22 SMART
low complexity region 387 400 N/A INTRINSIC
Pfam:Vps4_C 438 489 3.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165806
AA Change: V34A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000132514
Gene: ENSMUSG00000019794
AA Change: V34A

DomainStartEndE-ValueType
PDB:2RPA|A 1 74 6e-46 PDB
AAA 243 385 3.23e-20 SMART
low complexity region 389 402 N/A INTRINSIC
Pfam:Vps4_C 440 491 4.8e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173400
AA Change: V32A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133588
Gene: ENSMUSG00000019794
AA Change: V32A

DomainStartEndE-ValueType
PDB:2RPA|A 1 72 3e-47 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174654
Meta Mutation Damage Score 0.2607 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Microtubules, polymers of alpha and beta tubulin subunits, form the mitotic spindle of a dividing cell and help to organize membranous organelles during interphase. Katanin is a heterodimer that consists of a 60 kDa ATPase (p60 subunit A 1) and an 80 kDa accessory protein (p80 subunit B 1). The p60 subunit acts to sever and disassemble microtubules, while the p80 subunit targets the enzyme to the centrosome. This gene encodes the p80 subunit. This protein is a member of the AAA family of ATPases. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Feb 2011]
Allele List at MGI

All alleles(15) : Targeted(2) Gene trapped(13)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adgrb3 A T 1: 25,111,748 F1135I probably damaging Het
Arfgef3 A T 10: 18,600,600 F1490L probably damaging Het
Begain A G 12: 109,034,123 Y446H probably damaging Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dip2b C T 15: 100,186,301 T935M probably damaging Het
Eif2s2 T C 2: 154,888,270 T36A probably benign Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbxo10 T C 4: 45,048,470 Y555C probably damaging Het
Fpr2 C T 17: 17,893,753 T337I probably benign Het
Frem3 A T 8: 80,611,357 Q93L probably benign Het
Gapdh A G 6: 125,163,182 V119A possibly damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Hkdc1 T C 10: 62,391,372 I769V probably benign Het
Ifne T C 4: 88,879,601 *193W probably null Het
Nup107 T C 10: 117,761,332 I673V probably benign Het
Nup188 T A 2: 30,322,129 probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1510 G A 14: 52,410,308 A188V probably damaging Het
Olfr330 G T 11: 58,529,801 P62T probably damaging Het
Pcdhb5 T A 18: 37,320,752 S62T probably benign Het
Plekha5 T C 6: 140,526,479 V44A probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Ptprcap A G 19: 4,156,224 E102G probably benign Het
Ptprs A G 17: 56,426,404 V804A possibly damaging Het
Rab35 C A 5: 115,637,764 S34* probably null Het
Slco6d1 T A 1: 98,507,574 Y671* probably null Het
Sostdc1 A G 12: 36,317,166 I114V probably damaging Het
Tecta A G 9: 42,373,233 F852S possibly damaging Het
Tmem179 T C 12: 112,503,303 E21G probably benign Het
Tmem2 A G 19: 21,815,489 Q703R probably benign Het
Usp17la T A 7: 104,860,690 H167Q probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr17 A G 8: 54,664,964 probably null Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp985 A G 4: 147,584,079 D468G probably benign Het
Other mutations in Katna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Katna1 APN 10 7762804 missense probably damaging 1.00
IGL00332:Katna1 APN 10 7762994 utr 3 prime probably benign
IGL01385:Katna1 APN 10 7752810 missense probably damaging 1.00
IGL01592:Katna1 APN 10 7741454 missense probably damaging 1.00
P0018:Katna1 UTSW 10 7741459 missense probably damaging 1.00
R0310:Katna1 UTSW 10 7743749 intron probably benign
R2078:Katna1 UTSW 10 7743569 missense probably benign 0.00
R2975:Katna1 UTSW 10 7743709 missense probably benign 0.01
R3978:Katna1 UTSW 10 7752754 missense probably damaging 1.00
R3979:Katna1 UTSW 10 7752754 missense probably damaging 1.00
R4477:Katna1 UTSW 10 7738830 missense probably damaging 0.98
R5796:Katna1 UTSW 10 7760811 missense probably damaging 0.98
Z1176:Katna1 UTSW 10 7759785 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGGTCCATTGTAAACTTCC -3'
(R):5'- CCATGTAACCAAACTATATTCTCTGAG -3'

Sequencing Primer
(F):5'- GGAGCCCTGGAAAGTATATATACG -3'
(R):5'- TGAAGCTCTATGAGTCTGAAGCC -3'
Posted On2015-07-21