Incidental Mutation 'R4480:Hkdc1'
ID331436
Institutional Source Beutler Lab
Gene Symbol Hkdc1
Ensembl Gene ENSMUSG00000020080
Gene Namehexokinase domain containing 1
Synonyms
MMRRC Submission 041737-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R4480 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location62383137-62422491 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62391372 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 769 (I769V)
Ref Sequence ENSEMBL: ENSMUSP00000020277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020277]
Predicted Effect probably benign
Transcript: ENSMUST00000020277
AA Change: I769V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020277
Gene: ENSMUSG00000020080
AA Change: I769V

DomainStartEndE-ValueType
Pfam:Hexokinase_1 21 220 3.3e-71 PFAM
Pfam:Hexokinase_2 225 459 5.6e-79 PFAM
Pfam:Hexokinase_1 469 665 9.5e-76 PFAM
Pfam:Hexokinase_2 670 904 5.1e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159493
Meta Mutation Damage Score 0.0593 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hexokinase protein family. The encoded protein is involved in glucose metabolism, and reduced expression may be associated with gestational diabetes mellitus. High expression of this gene may also be associated with poor prognosis in hepatocarcinoma. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality prior to genotyping. Mice heterozygous for a knock-out allele exhibit impaired glucose tolerance and female-specific increased in hepatic triglyceride levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adgrb3 A T 1: 25,111,748 F1135I probably damaging Het
Arfgef3 A T 10: 18,600,600 F1490L probably damaging Het
Begain A G 12: 109,034,123 Y446H probably damaging Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dip2b C T 15: 100,186,301 T935M probably damaging Het
Eif2s2 T C 2: 154,888,270 T36A probably benign Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbxo10 T C 4: 45,048,470 Y555C probably damaging Het
Fpr2 C T 17: 17,893,753 T337I probably benign Het
Frem3 A T 8: 80,611,357 Q93L probably benign Het
Gapdh A G 6: 125,163,182 V119A possibly damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Ifne T C 4: 88,879,601 *193W probably null Het
Katna1 T C 10: 7,738,830 V32A probably damaging Het
Nup107 T C 10: 117,761,332 I673V probably benign Het
Nup188 T A 2: 30,322,129 probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1510 G A 14: 52,410,308 A188V probably damaging Het
Olfr330 G T 11: 58,529,801 P62T probably damaging Het
Pcdhb5 T A 18: 37,320,752 S62T probably benign Het
Plekha5 T C 6: 140,526,479 V44A probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Ptprcap A G 19: 4,156,224 E102G probably benign Het
Ptprs A G 17: 56,426,404 V804A possibly damaging Het
Rab35 C A 5: 115,637,764 S34* probably null Het
Slco6d1 T A 1: 98,507,574 Y671* probably null Het
Sostdc1 A G 12: 36,317,166 I114V probably damaging Het
Tecta A G 9: 42,373,233 F852S possibly damaging Het
Tmem179 T C 12: 112,503,303 E21G probably benign Het
Tmem2 A G 19: 21,815,489 Q703R probably benign Het
Usp17la T A 7: 104,860,690 H167Q probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr17 A G 8: 54,664,964 probably null Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp985 A G 4: 147,584,079 D468G probably benign Het
Other mutations in Hkdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Hkdc1 APN 10 62393789 missense probably damaging 0.99
IGL01300:Hkdc1 APN 10 62395261 splice site probably benign
IGL01415:Hkdc1 APN 10 62393859 missense probably damaging 1.00
IGL01935:Hkdc1 APN 10 62400386 missense probably damaging 0.97
IGL02903:Hkdc1 APN 10 62400191 critical splice donor site probably null
IGL03100:Hkdc1 APN 10 62417829 missense probably benign 0.00
IGL03154:Hkdc1 APN 10 62385705 missense probably damaging 1.00
R0368:Hkdc1 UTSW 10 62411707 missense probably null 0.04
R0549:Hkdc1 UTSW 10 62400240 missense probably benign
R0667:Hkdc1 UTSW 10 62411865 splice site probably benign
R0751:Hkdc1 UTSW 10 62398673 missense probably damaging 0.99
R1779:Hkdc1 UTSW 10 62391383 missense probably damaging 1.00
R1929:Hkdc1 UTSW 10 62417898 missense probably benign 0.01
R2271:Hkdc1 UTSW 10 62417898 missense probably benign 0.01
R3831:Hkdc1 UTSW 10 62400212 missense probably benign
R4561:Hkdc1 UTSW 10 62409839 missense probably benign 0.00
R4576:Hkdc1 UTSW 10 62385843 missense possibly damaging 0.56
R4655:Hkdc1 UTSW 10 62400463 missense probably benign 0.09
R4723:Hkdc1 UTSW 10 62400354 missense probably benign 0.00
R4810:Hkdc1 UTSW 10 62411525 missense probably benign 0.08
R5086:Hkdc1 UTSW 10 62395274 intron probably benign
R5138:Hkdc1 UTSW 10 62398691 missense probably damaging 1.00
R5781:Hkdc1 UTSW 10 62417933 missense probably damaging 0.98
R5900:Hkdc1 UTSW 10 62408666 missense possibly damaging 0.91
R5982:Hkdc1 UTSW 10 62393810 missense probably benign
R6418:Hkdc1 UTSW 10 62383804 missense possibly damaging 0.93
R6463:Hkdc1 UTSW 10 62393702 missense probably damaging 1.00
R6612:Hkdc1 UTSW 10 62395441 missense possibly damaging 0.48
R6673:Hkdc1 UTSW 10 62403606 missense probably damaging 0.99
R6761:Hkdc1 UTSW 10 62408698 missense possibly damaging 0.93
R6915:Hkdc1 UTSW 10 62401932 missense possibly damaging 0.92
R7114:Hkdc1 UTSW 10 62393843 missense probably damaging 1.00
R7395:Hkdc1 UTSW 10 62385699 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGAGTCTTCCTACCCAC -3'
(R):5'- TGACCGTGTGACTTGCTTTC -3'

Sequencing Primer
(F):5'- ACTGCTGGATGGCTTCAAAC -3'
(R):5'- GACTTGCTTTCCACACCCAGAC -3'
Posted On2015-07-21