Incidental Mutation 'R0099:Sgsm1'
ID 33144
Institutional Source Beutler Lab
Gene Symbol Sgsm1
Ensembl Gene ENSMUSG00000042216
Gene Name small G protein signaling modulator 1
Synonyms Rutbc2, 2410098H20Rik, D5Bwg1524e
MMRRC Submission 038385-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0099 (G1)
Quality Score 190
Status Validated (trace)
Chromosome 5
Chromosomal Location 113243220-113310786 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) C to A at 113274360 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048112] [ENSMUST00000057209] [ENSMUST00000112324] [ENSMUST00000112325] [ENSMUST00000154248]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000048112
SMART Domains Protein: ENSMUSP00000046544
Gene: ENSMUSG00000042216

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
TBC 559 1053 2.88e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057209
SMART Domains Protein: ENSMUSP00000084106
Gene: ENSMUSG00000042216

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
TBC 272 766 2.88e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112324
SMART Domains Protein: ENSMUSP00000107943
Gene: ENSMUSG00000042216

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112325
SMART Domains Protein: ENSMUSP00000107944
Gene: ENSMUSG00000042216

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
SCOP:d1fkma1 539 615 1e-6 SMART
Blast:TBC 559 675 1e-71 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147856
Predicted Effect probably benign
Transcript: ENSMUST00000154248
SMART Domains Protein: ENSMUSP00000114932
Gene: ENSMUSG00000042216

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
SCOP:d1fkma1 594 670 9e-7 SMART
Blast:TBC 614 706 3e-55 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156340
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930018M24Rik C T 14: 50,896,722 probably benign Het
Acad10 A C 5: 121,621,290 D1043E probably damaging Het
Adamtsl4 C T 3: 95,684,139 G173R probably benign Het
Astn1 G T 1: 158,502,151 S192I probably damaging Het
Atg2a T A 19: 6,252,789 V1010E probably damaging Het
C130079G13Rik A C 3: 59,936,435 K183N probably benign Het
Col11a2 A G 17: 34,049,674 E311G probably damaging Het
Col4a3 A C 1: 82,717,993 E1638A probably benign Het
Cstf2t A G 19: 31,083,831 R256G probably benign Het
Cyp4a12a T C 4: 115,326,672 L225P probably damaging Het
Diexf A G 1: 193,128,470 L75P probably damaging Het
Dnah5 G A 15: 28,239,934 R479H probably damaging Het
Dsg3 A G 18: 20,540,022 I917V probably benign Het
Fam76a G T 4: 132,910,787 probably benign Het
Fras1 T A 5: 96,614,917 probably null Het
Gli1 A G 10: 127,336,006 V293A probably damaging Het
Gm10782 T A 13: 56,363,143 noncoding transcript Het
Greb1l A G 18: 10,509,158 E490G probably damaging Het
Hydin G A 8: 110,589,561 G4362R probably damaging Het
Ica1 A T 6: 8,749,778 probably benign Het
Ikzf4 T A 10: 128,634,197 I485F probably damaging Het
Irf5 A G 6: 29,533,967 T34A probably damaging Het
Krt81 A T 15: 101,463,521 C59* probably null Het
Kynu T A 2: 43,629,053 probably null Het
Ly6g6c T C 17: 35,068,915 V61A probably damaging Het
Manea A C 4: 26,328,104 I312M probably damaging Het
Micall1 G T 15: 79,131,901 probably benign Het
Mthfs A T 9: 89,226,163 probably benign Het
Myh4 A G 11: 67,259,347 T1877A probably benign Het
Myo3a T C 2: 22,245,598 I92T probably benign Het
Nepn A G 10: 52,401,085 S306G probably damaging Het
Nol8 T C 13: 49,672,689 V995A probably benign Het
Olfr1453 A G 19: 13,027,801 F176S probably damaging Het
Olfr1458 T A 19: 13,103,140 T49S probably benign Het
Olfr160 A T 9: 37,711,454 V275E probably damaging Het
Olfr967 A G 9: 39,750,661 I92V possibly damaging Het
Pde1a T A 2: 79,868,313 probably null Het
Phf14 A G 6: 11,987,697 probably benign Het
Plekhh2 C T 17: 84,591,672 Q1026* probably null Het
Polr2b T A 5: 77,320,950 probably benign Het
Ppp1r36 G T 12: 76,436,282 probably null Het
Prdm14 A T 1: 13,118,945 C392S probably damaging Het
Rabgap1l A G 1: 160,682,116 S436P possibly damaging Het
Rfc2 A T 5: 134,595,281 probably null Het
Rfx4 A T 10: 84,894,304 M437L probably benign Het
Rgs17 T A 10: 5,842,583 R74S probably benign Het
Rnf139 C A 15: 58,899,415 L430I probably damaging Het
Skint6 T A 4: 112,811,501 T1126S possibly damaging Het
Slc15a2 T C 16: 36,753,036 E602G probably damaging Het
Stpg2 T C 3: 139,243,193 probably benign Het
Sycp2l T C 13: 41,129,525 probably benign Het
Tlr11 A T 14: 50,360,818 N87I probably benign Het
Tril A G 6: 53,818,363 F625L probably damaging Het
Ube3c T A 5: 29,607,064 V434E probably damaging Het
Usp34 G A 11: 23,363,111 G533R probably damaging Het
Zfp93 G T 7: 24,275,475 R295L probably benign Het
Other mutations in Sgsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Sgsm1 APN 5 113245064 missense probably benign 0.00
IGL00503:Sgsm1 APN 5 113276142 missense probably benign 0.00
IGL01377:Sgsm1 APN 5 113276182 splice site probably benign
IGL01602:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01605:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01669:Sgsm1 APN 5 113263490 missense probably benign
IGL01920:Sgsm1 APN 5 113273605 missense probably damaging 1.00
IGL01951:Sgsm1 APN 5 113286767 splice site probably benign
IGL02387:Sgsm1 APN 5 113253063 missense possibly damaging 0.93
IGL02690:Sgsm1 APN 5 113286767 splice site probably benign
IGL03177:Sgsm1 APN 5 113250993 missense probably damaging 1.00
IGL03186:Sgsm1 APN 5 113285021 missense probably benign 0.00
IGL03398:Sgsm1 APN 5 113255316 missense possibly damaging 0.67
caliente UTSW 5 113280462 intron probably benign
Chili UTSW 5 113258123 intron probably benign
pimiento UTSW 5 113263257 missense probably benign 0.15
R0048:Sgsm1 UTSW 5 113268750 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0082:Sgsm1 UTSW 5 113288836 missense probably benign 0.01
R0085:Sgsm1 UTSW 5 113279270 splice site probably benign
R0269:Sgsm1 UTSW 5 113286929 critical splice acceptor site probably null
R0310:Sgsm1 UTSW 5 113263705 missense probably benign 0.00
R0325:Sgsm1 UTSW 5 113288835 missense probably damaging 0.99
R0420:Sgsm1 UTSW 5 113263759 missense probably benign 0.16
R0594:Sgsm1 UTSW 5 113310562 missense probably benign 0.00
R0599:Sgsm1 UTSW 5 113245028 missense probably damaging 1.00
R0631:Sgsm1 UTSW 5 113285123 splice site probably benign
R0744:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0833:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0919:Sgsm1 UTSW 5 113258842 missense probably damaging 1.00
R0944:Sgsm1 UTSW 5 113265874 missense probably benign 0.40
R1169:Sgsm1 UTSW 5 113279485 missense probably damaging 1.00
R1232:Sgsm1 UTSW 5 113273711 nonsense probably null
R1473:Sgsm1 UTSW 5 113263257 missense probably benign 0.15
R1535:Sgsm1 UTSW 5 113263269 missense possibly damaging 0.93
R1796:Sgsm1 UTSW 5 113273617 missense possibly damaging 0.58
R1878:Sgsm1 UTSW 5 113263515 missense probably damaging 0.97
R2084:Sgsm1 UTSW 5 113285400 missense probably damaging 1.00
R3855:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R3856:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R4294:Sgsm1 UTSW 5 113285404 missense probably damaging 1.00
R4373:Sgsm1 UTSW 5 113258123 intron probably benign
R4558:Sgsm1 UTSW 5 113258111 intron probably benign
R4610:Sgsm1 UTSW 5 113255307 missense probably damaging 1.00
R4667:Sgsm1 UTSW 5 113260047 critical splice donor site probably null
R4838:Sgsm1 UTSW 5 113282626 missense probably damaging 1.00
R4890:Sgsm1 UTSW 5 113280462 intron probably benign
R4992:Sgsm1 UTSW 5 113282620 missense possibly damaging 0.89
R5366:Sgsm1 UTSW 5 113251039 missense possibly damaging 0.91
R5776:Sgsm1 UTSW 5 113250957 missense probably damaging 1.00
R5813:Sgsm1 UTSW 5 113250956 missense probably damaging 1.00
R6000:Sgsm1 UTSW 5 113286838 missense probably damaging 1.00
R6354:Sgsm1 UTSW 5 113282656 missense probably damaging 0.99
R6440:Sgsm1 UTSW 5 113279131 critical splice donor site probably null
R6831:Sgsm1 UTSW 5 113280380 missense probably damaging 0.97
R7307:Sgsm1 UTSW 5 113273646 missense probably benign 0.00
R7309:Sgsm1 UTSW 5 113268846 splice site probably null
R7387:Sgsm1 UTSW 5 113263700 missense probably damaging 1.00
R7439:Sgsm1 UTSW 5 113274321 missense probably damaging 0.99
R7485:Sgsm1 UTSW 5 113279635 splice site probably null
R7624:Sgsm1 UTSW 5 113274335 nonsense probably null
R7632:Sgsm1 UTSW 5 113276082 missense possibly damaging 0.54
R7669:Sgsm1 UTSW 5 113253024 missense probably damaging 1.00
R7727:Sgsm1 UTSW 5 113274327 missense possibly damaging 0.95
R7732:Sgsm1 UTSW 5 113266330 missense probably benign 0.26
R7961:Sgsm1 UTSW 5 113282644 missense probably damaging 1.00
R8088:Sgsm1 UTSW 5 113255268 missense probably damaging 1.00
R8213:Sgsm1 UTSW 5 113251011 missense probably damaging 1.00
R8278:Sgsm1 UTSW 5 113260092 missense probably damaging 0.98
R8480:Sgsm1 UTSW 5 113263418 missense probably benign 0.01
R8796:Sgsm1 UTSW 5 113263257 missense probably benign 0.15
R8816:Sgsm1 UTSW 5 113287231 missense probably damaging 1.00
R8904:Sgsm1 UTSW 5 113273629 missense probably benign 0.00
R8905:Sgsm1 UTSW 5 113273629 missense probably benign 0.00
R8952:Sgsm1 UTSW 5 113284995 missense probably damaging 1.00
R9046:Sgsm1 UTSW 5 113288859 missense probably damaging 1.00
R9162:Sgsm1 UTSW 5 113282711 missense probably damaging 1.00
R9249:Sgsm1 UTSW 5 113280335 missense possibly damaging 0.86
R9375:Sgsm1 UTSW 5 113274273 missense unknown
R9377:Sgsm1 UTSW 5 113288875 missense probably damaging 1.00
R9461:Sgsm1 UTSW 5 113276032 critical splice donor site probably null
R9662:Sgsm1 UTSW 5 113279231 missense probably benign 0.03
R9722:Sgsm1 UTSW 5 113280341 missense possibly damaging 0.75
R9726:Sgsm1 UTSW 5 113310552 missense probably benign
Z1177:Sgsm1 UTSW 5 113282710 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAAGTTGAGGATGCTGTCACTG -3'
(R):5'- CAACGCTATGAATGGCTGATCCCC -3'

Sequencing Primer
(F):5'- GTCTGAGAGATACCAAGTACTCTGC -3'
(R):5'- TGGCTGATCCCCCCAAC -3'
Posted On 2013-05-09