Incidental Mutation 'R4480:Begain'
ID331441
Institutional Source Beutler Lab
Gene Symbol Begain
Ensembl Gene ENSMUSG00000040867
Gene Namebrain-enriched guanylate kinase-associated
SynonymsLOC380785
MMRRC Submission 041737-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4480 (G1)
Quality Score189
Status Validated
Chromosome12
Chromosomal Location109032187-109068217 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109034123 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 446 (Y446H)
Ref Sequence ENSEMBL: ENSMUSP00000148247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000190647] [ENSMUST00000209829]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189236
Predicted Effect probably damaging
Transcript: ENSMUST00000190647
AA Change: Y241H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140393
Gene: ENSMUSG00000040867
AA Change: Y241H

DomainStartEndE-ValueType
SCOP:d1fxkc_ 18 132 2e-4 SMART
low complexity region 285 306 N/A INTRINSIC
low complexity region 309 326 N/A INTRINSIC
low complexity region 445 460 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209829
AA Change: Y446H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.1801 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adgrb3 A T 1: 25,111,748 F1135I probably damaging Het
Arfgef3 A T 10: 18,600,600 F1490L probably damaging Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dip2b C T 15: 100,186,301 T935M probably damaging Het
Eif2s2 T C 2: 154,888,270 T36A probably benign Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbxo10 T C 4: 45,048,470 Y555C probably damaging Het
Fpr2 C T 17: 17,893,753 T337I probably benign Het
Frem3 A T 8: 80,611,357 Q93L probably benign Het
Gapdh A G 6: 125,163,182 V119A possibly damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Hkdc1 T C 10: 62,391,372 I769V probably benign Het
Ifne T C 4: 88,879,601 *193W probably null Het
Katna1 T C 10: 7,738,830 V32A probably damaging Het
Nup107 T C 10: 117,761,332 I673V probably benign Het
Nup188 T A 2: 30,322,129 probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1510 G A 14: 52,410,308 A188V probably damaging Het
Olfr330 G T 11: 58,529,801 P62T probably damaging Het
Pcdhb5 T A 18: 37,320,752 S62T probably benign Het
Plekha5 T C 6: 140,526,479 V44A probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Ptprcap A G 19: 4,156,224 E102G probably benign Het
Ptprs A G 17: 56,426,404 V804A possibly damaging Het
Rab35 C A 5: 115,637,764 S34* probably null Het
Slco6d1 T A 1: 98,507,574 Y671* probably null Het
Sostdc1 A G 12: 36,317,166 I114V probably damaging Het
Tecta A G 9: 42,373,233 F852S possibly damaging Het
Tmem179 T C 12: 112,503,303 E21G probably benign Het
Tmem2 A G 19: 21,815,489 Q703R probably benign Het
Usp17la T A 7: 104,860,690 H167Q probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr17 A G 8: 54,664,964 probably null Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp985 A G 4: 147,584,079 D468G probably benign Het
Other mutations in Begain
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01951:Begain APN 12 109033645 missense probably benign 0.00
IGL02027:Begain APN 12 109034309 missense possibly damaging 0.80
IGL02186:Begain APN 12 109033352 missense probably damaging 1.00
IGL02219:Begain APN 12 109033730 missense probably benign 0.01
IGL02555:Begain APN 12 109034189 missense probably damaging 1.00
FR4342:Begain UTSW 12 109033418 unclassified probably benign
R0335:Begain UTSW 12 109038934 missense probably damaging 1.00
R1815:Begain UTSW 12 109034107 missense probably damaging 1.00
R1824:Begain UTSW 12 109033099 unclassified probably null
R1837:Begain UTSW 12 109035323 splice site probably benign
R1839:Begain UTSW 12 109035323 splice site probably benign
R2110:Begain UTSW 12 109033917 nonsense probably null
R2849:Begain UTSW 12 109033118 missense probably benign 0.17
R4692:Begain UTSW 12 109033892 missense probably damaging 1.00
R6425:Begain UTSW 12 109033394 missense probably damaging 1.00
R7205:Begain UTSW 12 109038868 missense possibly damaging 0.64
R7354:Begain UTSW 12 109033289 missense possibly damaging 0.91
R7369:Begain UTSW 12 109033927 missense possibly damaging 0.51
R7683:Begain UTSW 12 109033487 missense unknown
R7755:Begain UTSW 12 109052876 missense probably benign 0.01
R7807:Begain UTSW 12 109038930 missense probably damaging 1.00
RF008:Begain UTSW 12 109033437 nonsense probably null
RF012:Begain UTSW 12 109033427 unclassified probably benign
RF014:Begain UTSW 12 109033422 unclassified probably benign
RF020:Begain UTSW 12 109033424 unclassified probably benign
RF024:Begain UTSW 12 109033437 nonsense probably null
RF025:Begain UTSW 12 109033424 unclassified probably benign
RF049:Begain UTSW 12 109033414 unclassified probably benign
RF056:Begain UTSW 12 109033436 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTGCGGTTGAAGAACTCGTC -3'
(R):5'- TGCACATGGAGAAGCATGGC -3'

Sequencing Primer
(F):5'- TTGAAGAACTCGTCGCGGC -3'
(R):5'- GTCATCGCCAAAGTGCT -3'
Posted On2015-07-21