Incidental Mutation 'R4480:Gm3159'
ID331443
Institutional Source Beutler Lab
Gene Symbol Gm3159
Ensembl Gene ENSMUSG00000095056
Gene Namepredicted gene 3159
Synonyms
MMRRC Submission 041737-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4480 (G1)
Quality Score196
Status Validated
Chromosome14
Chromosomal Location4397526-4406347 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4398584 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 92 (Y92H)
Ref Sequence ENSEMBL: ENSMUSP00000137464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164038] [ENSMUST00000167245] [ENSMUST00000177764]
Predicted Effect probably damaging
Transcript: ENSMUST00000164038
AA Change: Y92H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126043
Gene: ENSMUSG00000095056
AA Change: Y92H

DomainStartEndE-ValueType
Pfam:Takusan 46 129 1.3e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167245
AA Change: Y92H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133201
Gene: ENSMUSG00000095056
AA Change: Y92H

DomainStartEndE-ValueType
Pfam:Takusan 48 128 5.1e-21 PFAM
transmembrane domain 240 262 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177764
AA Change: Y92H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137464
Gene: ENSMUSG00000095056
AA Change: Y92H

DomainStartEndE-ValueType
Pfam:Takusan 46 129 5.6e-30 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adgrb3 A T 1: 25,111,748 F1135I probably damaging Het
Arfgef3 A T 10: 18,600,600 F1490L probably damaging Het
Begain A G 12: 109,034,123 Y446H probably damaging Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dip2b C T 15: 100,186,301 T935M probably damaging Het
Eif2s2 T C 2: 154,888,270 T36A probably benign Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbxo10 T C 4: 45,048,470 Y555C probably damaging Het
Fpr2 C T 17: 17,893,753 T337I probably benign Het
Frem3 A T 8: 80,611,357 Q93L probably benign Het
Gapdh A G 6: 125,163,182 V119A possibly damaging Het
Hkdc1 T C 10: 62,391,372 I769V probably benign Het
Ifne T C 4: 88,879,601 *193W probably null Het
Katna1 T C 10: 7,738,830 V32A probably damaging Het
Nup107 T C 10: 117,761,332 I673V probably benign Het
Nup188 T A 2: 30,322,129 probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1510 G A 14: 52,410,308 A188V probably damaging Het
Olfr330 G T 11: 58,529,801 P62T probably damaging Het
Pcdhb5 T A 18: 37,320,752 S62T probably benign Het
Plekha5 T C 6: 140,526,479 V44A probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Ptprcap A G 19: 4,156,224 E102G probably benign Het
Ptprs A G 17: 56,426,404 V804A possibly damaging Het
Rab35 C A 5: 115,637,764 S34* probably null Het
Slco6d1 T A 1: 98,507,574 Y671* probably null Het
Sostdc1 A G 12: 36,317,166 I114V probably damaging Het
Tecta A G 9: 42,373,233 F852S possibly damaging Het
Tmem179 T C 12: 112,503,303 E21G probably benign Het
Tmem2 A G 19: 21,815,489 Q703R probably benign Het
Usp17la T A 7: 104,860,690 H167Q probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr17 A G 8: 54,664,964 probably null Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp985 A G 4: 147,584,079 D468G probably benign Het
Other mutations in Gm3159
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02960:Gm3159 APN 14 4400552 critical splice donor site probably null
R1398:Gm3159 UTSW 14 4398586 nonsense probably null
R4477:Gm3159 UTSW 14 4398584 missense probably damaging 1.00
R4479:Gm3159 UTSW 14 4398584 missense probably damaging 1.00
R5677:Gm3159 UTSW 14 4398582 missense probably damaging 0.97
R6957:Gm3159 UTSW 14 4398530 missense possibly damaging 0.94
R7366:Gm3159 UTSW 14 4398525 missense probably benign 0.27
R7514:Gm3159 UTSW 14 4399690 missense probably damaging 1.00
R7796:Gm3159 UTSW 14 4400560 makesense probably null
R7799:Gm3159 UTSW 14 4397585 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGCCATCAAGTATGCAAACTC -3'
(R):5'- ATCAGATTGCAAGCATCCCAGG -3'

Sequencing Primer
(F):5'- GGCCATCAAGTATGCAAACTCATTTG -3'
(R):5'- TGCAAGCATCCCAGGGTCAAG -3'
Posted On2015-07-21