Incidental Mutation 'R4480:Ptprcap'
ID331451
Institutional Source Beutler Lab
Gene Symbol Ptprcap
Ensembl Gene ENSMUSG00000045826
Gene Nameprotein tyrosine phosphatase, receptor type, C polypeptide-associated protein
SynonymsCD-45-AP, LSM-1
MMRRC Submission 041737-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R4480 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4154606-4156751 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4156224 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 102 (E102G)
Ref Sequence ENSEMBL: ENSMUSP00000053412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008893] [ENSMUST00000025749] [ENSMUST00000061086] [ENSMUST00000118483] [ENSMUST00000127605] [ENSMUST00000130469] [ENSMUST00000137431]
Predicted Effect probably benign
Transcript: ENSMUST00000008893
SMART Domains Protein: ENSMUSP00000008893
Gene: ENSMUSG00000024835

DomainStartEndE-ValueType
DUF1899 5 69 1.48e-37 SMART
WD40 68 111 2.1e-7 SMART
WD40 121 161 1.44e-5 SMART
WD40 164 204 4.08e-5 SMART
DUF1900 258 392 6.41e-88 SMART
coiled coil region 445 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025749
SMART Domains Protein: ENSMUSP00000025749
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
S_TKc 67 328 2.56e-103 SMART
S_TK_X 329 391 2.6e-26 SMART
low complexity region 406 421 N/A INTRINSIC
low complexity region 428 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061086
AA Change: E102G

PolyPhen 2 Score 0.414 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000053412
Gene: ENSMUSG00000045826
AA Change: E102G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 32 54 N/A INTRINSIC
Pfam:PTPRCAP 58 197 8.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118483
SMART Domains Protein: ENSMUSP00000112512
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
S_TKc 67 328 2.56e-103 SMART
S_TK_X 329 384 1.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127605
SMART Domains Protein: ENSMUSP00000123376
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
S_TKc 67 304 1.6e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130469
SMART Domains Protein: ENSMUSP00000117446
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
Pfam:Pkinase 67 153 2.7e-14 PFAM
Pfam:Pkinase_Tyr 67 153 9.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135911
Predicted Effect probably benign
Transcript: ENSMUST00000137431
SMART Domains Protein: ENSMUSP00000116744
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
Pfam:Pkinase_Tyr 67 277 4.6e-31 PFAM
Pfam:Pkinase 67 278 2.2e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154307
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified as a transmembrane phosphoprotein specifically associated with tyrosine phosphatase PTPRC/CD45, a key regulator of T- and B-lymphocyte activation. The interaction with PTPRC may be required for the stable expression of this protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired T and B cell responses to antigen receptor stimulation. Mice for a second knock-out allele show enlarged lymph nodes and increased lymph node cellularity but not significantly altered polyclonal T-cell responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adgrb3 A T 1: 25,111,748 F1135I probably damaging Het
Arfgef3 A T 10: 18,600,600 F1490L probably damaging Het
Begain A G 12: 109,034,123 Y446H probably damaging Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dip2b C T 15: 100,186,301 T935M probably damaging Het
Eif2s2 T C 2: 154,888,270 T36A probably benign Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbxo10 T C 4: 45,048,470 Y555C probably damaging Het
Fpr2 C T 17: 17,893,753 T337I probably benign Het
Frem3 A T 8: 80,611,357 Q93L probably benign Het
Gapdh A G 6: 125,163,182 V119A possibly damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Hkdc1 T C 10: 62,391,372 I769V probably benign Het
Ifne T C 4: 88,879,601 *193W probably null Het
Katna1 T C 10: 7,738,830 V32A probably damaging Het
Nup107 T C 10: 117,761,332 I673V probably benign Het
Nup188 T A 2: 30,322,129 probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1510 G A 14: 52,410,308 A188V probably damaging Het
Olfr330 G T 11: 58,529,801 P62T probably damaging Het
Pcdhb5 T A 18: 37,320,752 S62T probably benign Het
Plekha5 T C 6: 140,526,479 V44A probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Ptprs A G 17: 56,426,404 V804A possibly damaging Het
Rab35 C A 5: 115,637,764 S34* probably null Het
Slco6d1 T A 1: 98,507,574 Y671* probably null Het
Sostdc1 A G 12: 36,317,166 I114V probably damaging Het
Tecta A G 9: 42,373,233 F852S possibly damaging Het
Tmem179 T C 12: 112,503,303 E21G probably benign Het
Tmem2 A G 19: 21,815,489 Q703R probably benign Het
Usp17la T A 7: 104,860,690 H167Q probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr17 A G 8: 54,664,964 probably null Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp985 A G 4: 147,584,079 D468G probably benign Het
Other mutations in Ptprcap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02365:Ptprcap APN 19 4156268 missense probably benign
R0962:Ptprcap UTSW 19 4156464 missense possibly damaging 0.92
R1604:Ptprcap UTSW 19 4156074 nonsense probably null
R6338:Ptprcap UTSW 19 4156224 missense probably benign 0.41
R6522:Ptprcap UTSW 19 4156184 missense possibly damaging 0.95
R7358:Ptprcap UTSW 19 4156239 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CTCCAGTGTGGTCACCATTGTC -3'
(R):5'- AAGGCATGCAGGTCACTCAG -3'

Sequencing Primer
(F):5'- GTGGTCACCATTGTCCTGCTG -3'
(R):5'- ATGCAGGTCACTCAGCAGGG -3'
Posted On2015-07-21