Incidental Mutation 'R4482:Cyp4a10'
ID 331457
Institutional Source Beutler Lab
Gene Symbol Cyp4a10
Ensembl Gene ENSMUSG00000066072
Gene Name cytochrome P450, family 4, subfamily a, polypeptide 10
Synonyms RP1, D4Rp1, Cyp4a
MMRRC Submission 041738-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock # R4482 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 115518264-115533649 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 115532598 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 467 (F467L)
Ref Sequence ENSEMBL: ENSMUSP00000092486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058785] [ENSMUST00000094886]
AlphaFold O88833
Predicted Effect probably damaging
Transcript: ENSMUST00000058785
AA Change: F477L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061126
Gene: ENSMUSG00000066072
AA Change: F477L

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 504 2.3e-133 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094886
AA Change: F467L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092486
Gene: ENSMUSG00000066072
AA Change: F467L

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
Pfam:p450 51 494 4.5e-129 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display salt-sensitive hypertension, decrease sodium excretion, and decreased urine output. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik A G 11: 3,895,008 V27A possibly damaging Het
Actn3 A T 19: 4,863,408 probably null Het
Adamts20 T C 15: 94,345,920 Y642C probably damaging Het
Ankrd11 T C 8: 122,893,489 D1187G probably damaging Het
Bag4 T C 8: 25,785,044 probably benign Het
Bsn C A 9: 108,114,664 K1296N probably damaging Het
Cct5 T C 15: 31,597,569 D58G probably damaging Het
Dicer1 A G 12: 104,706,277 Y904H probably damaging Het
Fam160a2 A T 7: 105,389,674 F119L probably benign Het
Fbn1 A T 2: 125,363,610 probably null Het
Git1 T A 11: 77,500,507 Y189N possibly damaging Het
Gm732 T A X: 107,946,631 L225F possibly damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Itga6 T A 2: 71,855,915 I1059N probably damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kbtbd3 A T 9: 4,331,051 Y475F probably damaging Het
Map3k6 T C 4: 133,243,399 I199T probably benign Het
Mtmr7 T C 8: 40,554,384 M503V probably benign Het
Muc4 A G 16: 32,756,701 T2192A unknown Het
Nexn T C 3: 152,242,753 E391G probably damaging Het
Olfr190 G T 16: 59,074,923 H52Q probably benign Het
Parg A G 14: 32,262,774 I254V probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pomt2 G A 12: 87,131,830 P290S probably benign Het
Rasl10a T A 11: 5,058,429 Y42N probably damaging Het
Slc4a8 C A 15: 100,810,599 F871L probably damaging Het
Tdrd9 T C 12: 112,014,501 probably null Het
Trim21 G A 7: 102,563,933 Q53* probably null Het
Triobp T C 15: 78,966,563 S306P possibly damaging Het
Vasn A T 16: 4,648,326 T46S possibly damaging Het
Zfp236 A T 18: 82,644,221 F529Y probably benign Het
Other mutations in Cyp4a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00774:Cyp4a10 APN 4 115532538 missense probably damaging 1.00
IGL01301:Cyp4a10 APN 4 115518455 missense probably damaging 1.00
IGL02081:Cyp4a10 APN 4 115521172 missense possibly damaging 0.87
IGL02373:Cyp4a10 APN 4 115521077 nonsense probably null
IGL03411:Cyp4a10 APN 4 115525693 splice site probably null
ANU18:Cyp4a10 UTSW 4 115518455 missense probably damaging 1.00
PIT4142001:Cyp4a10 UTSW 4 115524875 missense probably damaging 0.99
PIT4151001:Cyp4a10 UTSW 4 115524875 missense probably damaging 0.99
R0016:Cyp4a10 UTSW 4 115521107 missense probably damaging 1.00
R0368:Cyp4a10 UTSW 4 115525377 nonsense probably null
R1319:Cyp4a10 UTSW 4 115521145 missense probably damaging 0.98
R1440:Cyp4a10 UTSW 4 115529449 missense probably damaging 1.00
R1531:Cyp4a10 UTSW 4 115518435 nonsense probably null
R2008:Cyp4a10 UTSW 4 115525392 missense probably damaging 0.98
R2064:Cyp4a10 UTSW 4 115524720 splice site probably benign
R2083:Cyp4a10 UTSW 4 115525308 missense possibly damaging 0.86
R2961:Cyp4a10 UTSW 4 115520270 missense probably benign 0.02
R3028:Cyp4a10 UTSW 4 115518431 missense possibly damaging 0.64
R3839:Cyp4a10 UTSW 4 115525347 missense possibly damaging 0.85
R3930:Cyp4a10 UTSW 4 115524783 missense probably benign 0.00
R4062:Cyp4a10 UTSW 4 115519701 missense probably benign 0.06
R4097:Cyp4a10 UTSW 4 115529283 missense probably damaging 0.99
R4298:Cyp4a10 UTSW 4 115532692 missense probably damaging 1.00
R4592:Cyp4a10 UTSW 4 115529493 missense probably damaging 0.99
R4715:Cyp4a10 UTSW 4 115525338 missense probably benign 0.44
R4826:Cyp4a10 UTSW 4 115518344 missense probably benign 0.00
R4834:Cyp4a10 UTSW 4 115525808 missense probably damaging 1.00
R4922:Cyp4a10 UTSW 4 115521094 missense probably benign 0.01
R5202:Cyp4a10 UTSW 4 115532615 missense probably damaging 1.00
R5502:Cyp4a10 UTSW 4 115525505 missense probably benign 0.21
R6269:Cyp4a10 UTSW 4 115524312 missense probably damaging 1.00
R6349:Cyp4a10 UTSW 4 115525358 missense probably benign 0.00
R7684:Cyp4a10 UTSW 4 115518352 missense probably benign 0.18
R7863:Cyp4a10 UTSW 4 115518425 missense probably benign 0.00
R8392:Cyp4a10 UTSW 4 115529478 nonsense probably null
R8445:Cyp4a10 UTSW 4 115525594 missense probably damaging 1.00
R8744:Cyp4a10 UTSW 4 115529470 missense probably benign 0.00
R9264:Cyp4a10 UTSW 4 115524278 missense probably benign 0.03
R9297:Cyp4a10 UTSW 4 115521178 missense probably damaging 1.00
R9299:Cyp4a10 UTSW 4 115519750 missense probably benign 0.00
R9393:Cyp4a10 UTSW 4 115525369 missense probably damaging 1.00
Z1176:Cyp4a10 UTSW 4 115518326 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACCTGTGACAGTAGGCC -3'
(R):5'- CAGTCAGATGTGGGTAGCAG -3'

Sequencing Primer
(F):5'- CTGTGACAGTAGGCCCTGAATG -3'
(R):5'- AATCTAGAGCAAGGTGTGTGTG -3'
Posted On 2015-07-21