Incidental Mutation 'R4482:Trim21'
ID331459
Institutional Source Beutler Lab
Gene Symbol Trim21
Ensembl Gene ENSMUSG00000030966
Gene Nametripartite motif-containing 21
SynonymsSsa1, Ro52
MMRRC Submission 041738-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4482 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location102557921-102565486 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 102563933 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 53 (Q53*)
Ref Sequence ENSEMBL: ENSMUSP00000102526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033264] [ENSMUST00000106913]
Predicted Effect probably null
Transcript: ENSMUST00000033264
AA Change: Q53*
SMART Domains Protein: ENSMUSP00000033264
Gene: ENSMUSG00000030966
AA Change: Q53*

DomainStartEndE-ValueType
RING 12 50 6e-8 SMART
BBOX 83 124 2.71e-15 SMART
coiled coil region 184 242 N/A INTRINSIC
PRY 282 334 1.08e-23 SMART
SPRY 335 461 8.9e-35 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106913
AA Change: Q53*
SMART Domains Protein: ENSMUSP00000102526
Gene: ENSMUSG00000030966
AA Change: Q53*

DomainStartEndE-ValueType
RING 12 50 6e-8 SMART
BBOX 83 124 2.71e-15 SMART
coiled coil region 184 242 N/A INTRINSIC
PRY 282 334 1.08e-23 SMART
SPRY 335 461 8.9e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210261
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210551
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The encoded protein is part of the RoSSA ribonucleoprotein, which includes a single polypeptide and one of four small RNA molecules. The RoSSA particle localizes to both the cytoplasm and the nucleus. RoSSA interacts with autoantigens in patients with Sjogren syndrome and systemic lupus erythematosus. Alternatively spliced transcript variants for this gene have been described but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Unmanipulated homozygous mice are normal, but leads to tissue inflammation and systemic autoimmunity in vivo and reduced number of CD11c+ dendritic cells from mutant bone marrow in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik A G 11: 3,895,008 V27A possibly damaging Het
Actn3 A T 19: 4,863,408 probably null Het
Adamts20 T C 15: 94,345,920 Y642C probably damaging Het
Ankrd11 T C 8: 122,893,489 D1187G probably damaging Het
Bag4 T C 8: 25,785,044 probably benign Het
Bsn C A 9: 108,114,664 K1296N probably damaging Het
Cct5 T C 15: 31,597,569 D58G probably damaging Het
Cyp4a10 T C 4: 115,532,598 F467L probably damaging Het
Dicer1 A G 12: 104,706,277 Y904H probably damaging Het
Fam160a2 A T 7: 105,389,674 F119L probably benign Het
Fbn1 A T 2: 125,363,610 probably null Het
Git1 T A 11: 77,500,507 Y189N possibly damaging Het
Gm732 T A X: 107,946,631 L225F possibly damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Itga6 T A 2: 71,855,915 I1059N probably damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kbtbd3 A T 9: 4,331,051 Y475F probably damaging Het
Map3k6 T C 4: 133,243,399 I199T probably benign Het
Mtmr7 T C 8: 40,554,384 M503V probably benign Het
Muc4 A G 16: 32,756,701 T2192A unknown Het
Nexn T C 3: 152,242,753 E391G probably damaging Het
Olfr190 G T 16: 59,074,923 H52Q probably benign Het
Parg A G 14: 32,262,774 I254V probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pomt2 G A 12: 87,131,830 P290S probably benign Het
Rasl10a T A 11: 5,058,429 Y42N probably damaging Het
Slc4a8 C A 15: 100,810,599 F871L probably damaging Het
Tdrd9 T C 12: 112,014,501 probably null Het
Triobp T C 15: 78,966,563 S306P possibly damaging Het
Vasn A T 16: 4,648,326 T46S possibly damaging Het
Zfp236 A T 18: 82,644,221 F529Y probably benign Het
Other mutations in Trim21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Trim21 APN 7 102559598 missense probably damaging 1.00
IGL01729:Trim21 APN 7 102563893 missense probably damaging 0.97
IGL02680:Trim21 APN 7 102559663 missense probably benign 0.44
IGL03349:Trim21 APN 7 102563277 missense probably benign 0.00
R1508:Trim21 UTSW 7 102559576 missense possibly damaging 0.52
R1662:Trim21 UTSW 7 102561898 nonsense probably null
R2904:Trim21 UTSW 7 102559971 missense probably benign 0.00
R5480:Trim21 UTSW 7 102559256 missense probably benign 0.05
R5606:Trim21 UTSW 7 102559606 missense probably damaging 0.99
R6130:Trim21 UTSW 7 102563291 missense possibly damaging 0.95
R6214:Trim21 UTSW 7 102559439 missense probably damaging 0.96
R6215:Trim21 UTSW 7 102559439 missense probably damaging 0.96
R6291:Trim21 UTSW 7 102564082 missense probably damaging 1.00
R6731:Trim21 UTSW 7 102559212 missense probably damaging 1.00
R7612:Trim21 UTSW 7 102559535 missense probably benign 0.01
R8008:Trim21 UTSW 7 102559976 missense not run
Predicted Primers PCR Primer
(F):5'- TTCAATAGGGACCCTGGTGTGG -3'
(R):5'- TTCCACGGCAGATATCACCC -3'

Sequencing Primer
(F):5'- CGGTGTTTCCCAGACTGG -3'
(R):5'- CTCTACAACCTCAAAAATGTCTCTGG -3'
Posted On2015-07-21