Incidental Mutation 'R4482:Homer3'
ID331463
Institutional Source Beutler Lab
Gene Symbol Homer3
Ensembl Gene ENSMUSG00000003573
Gene Namehomer scaffolding protein 3
Synonyms
MMRRC Submission 041738-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R4482 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location70282827-70294361 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 70290143 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000003669] [ENSMUST00000008004] [ENSMUST00000087467] [ENSMUST00000110124] [ENSMUST00000140212]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003669
AA Change: R168Q

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003669
Gene: ENSMUSG00000003573
AA Change: R168Q

DomainStartEndE-ValueType
WH1 4 110 4.92e-37 SMART
low complexity region 198 210 N/A INTRINSIC
PDB:3CVF|D 285 342 2e-10 PDB
low complexity region 343 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000008004
SMART Domains Protein: ENSMUSP00000008004
Gene: ENSMUSG00000057788

DomainStartEndE-ValueType
DEXDc 21 222 1.85e-57 SMART
HELICc 262 343 2.41e-29 SMART
low complexity region 369 383 N/A INTRINSIC
low complexity region 461 470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087467
SMART Domains Protein: ENSMUSP00000084735
Gene: ENSMUSG00000003573

DomainStartEndE-ValueType
Pfam:WH1 1 107 4.2e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110124
AA Change: R168Q

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105751
Gene: ENSMUSG00000003573
AA Change: R168Q

DomainStartEndE-ValueType
WH1 4 110 4.92e-37 SMART
low complexity region 198 210 N/A INTRINSIC
PDB:3CVF|D 285 342 2e-10 PDB
low complexity region 343 358 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127094
Predicted Effect probably null
Transcript: ENSMUST00000135368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135692
Predicted Effect possibly damaging
Transcript: ENSMUST00000140212
AA Change: R168Q

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117033
Gene: ENSMUSG00000003573
AA Change: R168Q

DomainStartEndE-ValueType
WH1 4 110 4.92e-37 SMART
low complexity region 198 210 N/A INTRINSIC
PDB:3CVF|D 282 339 2e-10 PDB
low complexity region 340 355 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155711
Meta Mutation Damage Score 0.3504 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HOMER family of postsynaptic density scaffolding proteins that share a similar domain structure consisting of an N-terminal Enabled/vasodilator-stimulated phosphoprotein homology 1 domain which mediates protein-protein interactions, and a carboxy-terminal coiled-coil domain and two leucine zipper motifs that are involved in self-oligomerization. The encoded protein binds numerous other proteins including group I metabotropic glutamate receptors, inositol 1,4,5-trisphosphate receptors and amyloid precursor proteins and has been implicated in diverse biological functions such as neuronal signaling, T-cell activation and trafficking of amyloid beta peptides. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous mutants exhibit normal sensitivity to cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik A G 11: 3,895,008 V27A possibly damaging Het
Actn3 A T 19: 4,863,408 probably null Het
Adamts20 T C 15: 94,345,920 Y642C probably damaging Het
Ankrd11 T C 8: 122,893,489 D1187G probably damaging Het
Bag4 T C 8: 25,785,044 probably benign Het
Bsn C A 9: 108,114,664 K1296N probably damaging Het
Cct5 T C 15: 31,597,569 D58G probably damaging Het
Cyp4a10 T C 4: 115,532,598 F467L probably damaging Het
Dicer1 A G 12: 104,706,277 Y904H probably damaging Het
Fam160a2 A T 7: 105,389,674 F119L probably benign Het
Fbn1 A T 2: 125,363,610 probably null Het
Git1 T A 11: 77,500,507 Y189N possibly damaging Het
Gm732 T A X: 107,946,631 L225F possibly damaging Het
Itga6 T A 2: 71,855,915 I1059N probably damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kbtbd3 A T 9: 4,331,051 Y475F probably damaging Het
Map3k6 T C 4: 133,243,399 I199T probably benign Het
Mtmr7 T C 8: 40,554,384 M503V probably benign Het
Muc4 A G 16: 32,756,701 T2192A unknown Het
Nexn T C 3: 152,242,753 E391G probably damaging Het
Olfr190 G T 16: 59,074,923 H52Q probably benign Het
Parg A G 14: 32,262,774 I254V probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pomt2 G A 12: 87,131,830 P290S probably benign Het
Rasl10a T A 11: 5,058,429 Y42N probably damaging Het
Slc4a8 C A 15: 100,810,599 F871L probably damaging Het
Tdrd9 T C 12: 112,014,501 probably null Het
Trim21 G A 7: 102,563,933 Q53* probably null Het
Triobp T C 15: 78,966,563 S306P possibly damaging Het
Vasn A T 16: 4,648,326 T46S possibly damaging Het
Zfp236 A T 18: 82,644,221 F529Y probably benign Het
Other mutations in Homer3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01966:Homer3 APN 8 70290157 missense probably damaging 0.96
IGL02493:Homer3 APN 8 70290071 missense probably benign 0.00
IGL03134:Homer3 UTSW 8 70286335 missense probably benign 0.00
R2436:Homer3 UTSW 8 70293056 missense possibly damaging 0.91
R3508:Homer3 UTSW 8 70291355 missense probably benign 0.06
R4391:Homer3 UTSW 8 70290143 unclassified probably null
R4392:Homer3 UTSW 8 70290143 unclassified probably null
R4395:Homer3 UTSW 8 70290143 unclassified probably null
R4396:Homer3 UTSW 8 70290143 unclassified probably null
R4397:Homer3 UTSW 8 70290143 unclassified probably null
R4401:Homer3 UTSW 8 70290143 unclassified probably null
R4402:Homer3 UTSW 8 70290143 unclassified probably null
R4445:Homer3 UTSW 8 70290143 unclassified probably null
R4446:Homer3 UTSW 8 70290143 unclassified probably null
R4488:Homer3 UTSW 8 70290143 unclassified probably null
R4489:Homer3 UTSW 8 70290143 unclassified probably null
R4664:Homer3 UTSW 8 70290143 unclassified probably null
R4666:Homer3 UTSW 8 70290143 unclassified probably null
R4751:Homer3 UTSW 8 70285434 missense probably damaging 1.00
R5071:Homer3 UTSW 8 70291355 missense probably benign
R5828:Homer3 UTSW 8 70286306 missense probably benign 0.02
R6052:Homer3 UTSW 8 70291426 nonsense probably null
R6211:Homer3 UTSW 8 70285524 missense probably damaging 1.00
R6234:Homer3 UTSW 8 70291165 critical splice donor site probably null
R6895:Homer3 UTSW 8 70285305 missense probably damaging 0.99
R6914:Homer3 UTSW 8 70291551 missense probably benign 0.00
R6942:Homer3 UTSW 8 70291551 missense probably benign 0.00
R7300:Homer3 UTSW 8 70285303 start codon destroyed probably null 0.23
R7391:Homer3 UTSW 8 70289484 missense probably benign 0.00
R7553:Homer3 UTSW 8 70290124 missense probably benign 0.02
R7555:Homer3 UTSW 8 70289413 missense probably damaging 1.00
R7721:Homer3 UTSW 8 70291012 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TACCCCAGTGGCTTCAATCAAC -3'
(R):5'- TTAGTGACAATCAAGACCCTGAC -3'

Sequencing Primer
(F):5'- CCAGTGGCTTCAATCAACTTTAC -3'
(R):5'- AATTTCTGAGTTCGAGGCCAGC -3'
Posted On2015-07-21