Incidental Mutation 'R4482:Rasl10a'
ID331468
Institutional Source Beutler Lab
Gene Symbol Rasl10a
Ensembl Gene ENSMUSG00000034209
Gene NameRAS-like, family 10, member A
Synonyms
MMRRC Submission 041738-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R4482 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location5058128-5060385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5058429 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 42 (Y42N)
Ref Sequence ENSEMBL: ENSMUSP00000048453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037146] [ENSMUST00000037218] [ENSMUST00000056649] [ENSMUST00000109895]
Predicted Effect probably benign
Transcript: ENSMUST00000037146
SMART Domains Protein: ENSMUSP00000043709
Gene: ENSMUSG00000034201

DomainStartEndE-ValueType
CH 29 143 2.69e-16 SMART
GAS2 206 278 7.69e-52 SMART
low complexity region 292 318 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000037218
AA Change: Y42N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048453
Gene: ENSMUSG00000034209
AA Change: Y42N

DomainStartEndE-ValueType
Pfam:Ras 6 180 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056649
SMART Domains Protein: ENSMUSP00000050275
Gene: ENSMUSG00000034201

DomainStartEndE-ValueType
CH 29 143 2.69e-16 SMART
GAS2 206 278 7.69e-52 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 335 365 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 460 473 N/A INTRINSIC
low complexity region 478 496 N/A INTRINSIC
low complexity region 509 539 N/A INTRINSIC
low complexity region 546 568 N/A INTRINSIC
low complexity region 641 657 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109895
SMART Domains Protein: ENSMUSP00000105521
Gene: ENSMUSG00000034201

DomainStartEndE-ValueType
CH 29 143 2.69e-16 SMART
GAS2 206 278 7.69e-52 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 335 365 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 460 473 N/A INTRINSIC
low complexity region 478 496 N/A INTRINSIC
low complexity region 509 539 N/A INTRINSIC
low complexity region 546 568 N/A INTRINSIC
low complexity region 641 657 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156196
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik A G 11: 3,895,008 V27A possibly damaging Het
Actn3 A T 19: 4,863,408 probably null Het
Adamts20 T C 15: 94,345,920 Y642C probably damaging Het
Ankrd11 T C 8: 122,893,489 D1187G probably damaging Het
Bag4 T C 8: 25,785,044 probably benign Het
Bsn C A 9: 108,114,664 K1296N probably damaging Het
Cct5 T C 15: 31,597,569 D58G probably damaging Het
Cyp4a10 T C 4: 115,532,598 F467L probably damaging Het
Dicer1 A G 12: 104,706,277 Y904H probably damaging Het
Fam160a2 A T 7: 105,389,674 F119L probably benign Het
Fbn1 A T 2: 125,363,610 probably null Het
Git1 T A 11: 77,500,507 Y189N possibly damaging Het
Gm732 T A X: 107,946,631 L225F possibly damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Itga6 T A 2: 71,855,915 I1059N probably damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kbtbd3 A T 9: 4,331,051 Y475F probably damaging Het
Map3k6 T C 4: 133,243,399 I199T probably benign Het
Mtmr7 T C 8: 40,554,384 M503V probably benign Het
Muc4 A G 16: 32,756,701 T2192A unknown Het
Nexn T C 3: 152,242,753 E391G probably damaging Het
Olfr190 G T 16: 59,074,923 H52Q probably benign Het
Parg A G 14: 32,262,774 I254V probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pomt2 G A 12: 87,131,830 P290S probably benign Het
Slc4a8 C A 15: 100,810,599 F871L probably damaging Het
Tdrd9 T C 12: 112,014,501 probably null Het
Trim21 G A 7: 102,563,933 Q53* probably null Het
Triobp T C 15: 78,966,563 S306P possibly damaging Het
Vasn A T 16: 4,648,326 T46S possibly damaging Het
Zfp236 A T 18: 82,644,221 F529Y probably benign Het
Other mutations in Rasl10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02233:Rasl10a APN 11 5058333 missense probably damaging 0.99
IGL03149:Rasl10a APN 11 5058429 missense possibly damaging 0.80
R1630:Rasl10a UTSW 11 5059542 missense probably damaging 0.99
R1678:Rasl10a UTSW 11 5059815 missense possibly damaging 0.61
R1925:Rasl10a UTSW 11 5059473 missense possibly damaging 0.84
R2086:Rasl10a UTSW 11 5059431 critical splice acceptor site probably null
R3792:Rasl10a UTSW 11 5059461 missense probably damaging 0.99
R4719:Rasl10a UTSW 11 5058517 missense probably benign 0.03
R5743:Rasl10a UTSW 11 5059519 missense probably benign 0.02
R6168:Rasl10a UTSW 11 5058442 missense possibly damaging 0.76
R6530:Rasl10a UTSW 11 5058367 missense probably damaging 1.00
R6684:Rasl10a UTSW 11 5058396 missense possibly damaging 0.49
R8049:Rasl10a UTSW 11 5059823
Predicted Primers PCR Primer
(F):5'- GCGGCTTCGGTTTTGAAAC -3'
(R):5'- GCAGGAAGCTCGTATGCAAAC -3'

Sequencing Primer
(F):5'- GACAGTTACCTCATCGCCG -3'
(R):5'- GGAAGCTCGTATGCAAACTACCTAG -3'
Posted On2015-07-21