Incidental Mutation 'R4482:Dicer1'
ID 331471
Institutional Source Beutler Lab
Gene Symbol Dicer1
Ensembl Gene ENSMUSG00000041415
Gene Name dicer 1, ribonuclease type III
Synonyms D12Ertd7e, Dicer1, 1110006F08Rik
MMRRC Submission 041738-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4482 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 104654001-104718211 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104672536 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 904 (Y904H)
Ref Sequence ENSEMBL: ENSMUSP00000043676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041987]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000041987
AA Change: Y904H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043676
Gene: ENSMUSG00000041415
AA Change: Y904H

DomainStartEndE-ValueType
DEXDc 30 233 5.14e-24 SMART
low complexity region 403 419 N/A INTRINSIC
HELICc 449 546 3.15e-10 SMART
Pfam:Dicer_dimer 620 707 1.4e-25 PFAM
low complexity region 713 723 N/A INTRINSIC
PAZ 881 1056 1.67e-48 SMART
Blast:PAZ 1080 1129 2e-8 BLAST
RIBOc 1285 1582 1.83e-35 SMART
RIBOc 1665 1831 5.97e-49 SMART
DSRM 1834 1897 6.89e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222528
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein possessing an RNA helicase motif containing a DEXH box in its amino terminus and an RNA motif in the carboxy terminus. The encoded protein functions as a ribonuclease and is required by the RNA interference and small temporal RNA (stRNA) pathways to produce the active small RNA component that represses gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mutation of this locus results in arrest of early embryonic development. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(14) Gene trapped(11)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik A G 11: 3,845,008 (GRCm39) V27A possibly damaging Het
Actn3 A T 19: 4,913,436 (GRCm39) probably null Het
Adamts20 T C 15: 94,243,801 (GRCm39) Y642C probably damaging Het
Ankrd11 T C 8: 123,620,228 (GRCm39) D1187G probably damaging Het
Bag4 T C 8: 26,275,072 (GRCm39) probably benign Het
Bsn C A 9: 107,991,863 (GRCm39) K1296N probably damaging Het
Cct5 T C 15: 31,597,715 (GRCm39) D58G probably damaging Het
Cyp4a10 T C 4: 115,389,795 (GRCm39) F467L probably damaging Het
Fbn1 A T 2: 125,205,530 (GRCm39) probably null Het
Fhip1b A T 7: 105,038,881 (GRCm39) F119L probably benign Het
Git1 T A 11: 77,391,333 (GRCm39) Y189N possibly damaging Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Itga6 T A 2: 71,686,259 (GRCm39) I1059N probably damaging Het
Kalrn C T 16: 33,810,180 (GRCm39) D2525N possibly damaging Het
Kbtbd3 A T 9: 4,331,051 (GRCm39) Y475F probably damaging Het
Map3k6 T C 4: 132,970,710 (GRCm39) I199T probably benign Het
Mtmr7 T C 8: 41,007,425 (GRCm39) M503V probably benign Het
Muc4 A G 16: 32,577,075 (GRCm39) T2192A unknown Het
Nexn T C 3: 151,948,390 (GRCm39) E391G probably damaging Het
Or5h22 G T 16: 58,895,286 (GRCm39) H52Q probably benign Het
Parg A G 14: 31,984,731 (GRCm39) I254V probably damaging Het
Plxna2 C T 1: 194,431,625 (GRCm39) S538F probably damaging Het
Pomt2 G A 12: 87,178,604 (GRCm39) P290S probably benign Het
Rasl10a T A 11: 5,008,429 (GRCm39) Y42N probably damaging Het
Slc4a8 C A 15: 100,708,480 (GRCm39) F871L probably damaging Het
Tdrd9 T C 12: 111,980,935 (GRCm39) probably null Het
Trim21 G A 7: 102,213,140 (GRCm39) Q53* probably null Het
Triobp T C 15: 78,850,763 (GRCm39) S306P possibly damaging Het
Vasn A T 16: 4,466,190 (GRCm39) T46S possibly damaging Het
Wmp T A X: 106,990,237 (GRCm39) L225F possibly damaging Het
Zfp236 A T 18: 82,662,346 (GRCm39) F529Y probably benign Het
Other mutations in Dicer1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Dicer1 APN 12 104,663,031 (GRCm39) missense possibly damaging 0.93
IGL01061:Dicer1 APN 12 104,672,586 (GRCm39) missense probably null 0.75
IGL01527:Dicer1 APN 12 104,657,869 (GRCm39) nonsense probably null
IGL01597:Dicer1 APN 12 104,671,469 (GRCm39) nonsense probably null
IGL01636:Dicer1 APN 12 104,688,500 (GRCm39) missense probably damaging 1.00
IGL01717:Dicer1 APN 12 104,669,046 (GRCm39) nonsense probably null
IGL01765:Dicer1 APN 12 104,672,999 (GRCm39) missense probably damaging 1.00
IGL01871:Dicer1 APN 12 104,670,439 (GRCm39) missense probably damaging 1.00
IGL02316:Dicer1 APN 12 104,668,812 (GRCm39) missense probably damaging 1.00
IGL02317:Dicer1 APN 12 104,663,279 (GRCm39) missense probably damaging 1.00
IGL02539:Dicer1 APN 12 104,663,294 (GRCm39) missense probably damaging 0.97
IGL02544:Dicer1 APN 12 104,681,091 (GRCm39) missense probably damaging 1.00
IGL02664:Dicer1 APN 12 104,671,388 (GRCm39) missense probably damaging 1.00
IGL02667:Dicer1 APN 12 104,681,165 (GRCm39) missense probably damaging 1.00
IGL03353:Dicer1 APN 12 104,679,366 (GRCm39) missense probably damaging 1.00
IGL03377:Dicer1 APN 12 104,678,456 (GRCm39) missense probably damaging 0.98
everest UTSW 12 104,671,387 (GRCm39) missense probably damaging 1.00
PIT4480001:Dicer1 UTSW 12 104,662,803 (GRCm39) missense probably benign
R0032:Dicer1 UTSW 12 104,671,057 (GRCm39) nonsense probably null
R0032:Dicer1 UTSW 12 104,671,057 (GRCm39) nonsense probably null
R0219:Dicer1 UTSW 12 104,658,384 (GRCm39) critical splice donor site probably null
R0242:Dicer1 UTSW 12 104,668,710 (GRCm39) missense probably benign 0.02
R0242:Dicer1 UTSW 12 104,668,710 (GRCm39) missense probably benign 0.02
R0385:Dicer1 UTSW 12 104,670,433 (GRCm39) missense probably damaging 1.00
R0402:Dicer1 UTSW 12 104,697,323 (GRCm39) missense probably benign 0.04
R0426:Dicer1 UTSW 12 104,668,801 (GRCm39) missense probably damaging 1.00
R0453:Dicer1 UTSW 12 104,668,889 (GRCm39) missense probably benign
R0502:Dicer1 UTSW 12 104,671,319 (GRCm39) missense probably damaging 1.00
R0507:Dicer1 UTSW 12 104,657,917 (GRCm39) missense probably damaging 1.00
R0511:Dicer1 UTSW 12 104,669,100 (GRCm39) missense possibly damaging 0.95
R0523:Dicer1 UTSW 12 104,668,750 (GRCm39) missense probably damaging 1.00
R0559:Dicer1 UTSW 12 104,672,560 (GRCm39) missense probably damaging 1.00
R0600:Dicer1 UTSW 12 104,673,123 (GRCm39) missense probably damaging 1.00
R0707:Dicer1 UTSW 12 104,673,144 (GRCm39) missense probably damaging 1.00
R1225:Dicer1 UTSW 12 104,657,866 (GRCm39) missense probably damaging 0.98
R1351:Dicer1 UTSW 12 104,695,401 (GRCm39) missense probably damaging 0.99
R1449:Dicer1 UTSW 12 104,695,502 (GRCm39) missense possibly damaging 0.85
R1575:Dicer1 UTSW 12 104,688,228 (GRCm39) critical splice donor site probably null
R1642:Dicer1 UTSW 12 104,679,415 (GRCm39) missense probably damaging 1.00
R1651:Dicer1 UTSW 12 104,675,064 (GRCm39) missense probably damaging 1.00
R1658:Dicer1 UTSW 12 104,666,673 (GRCm39) missense probably benign
R1815:Dicer1 UTSW 12 104,688,410 (GRCm39) missense probably damaging 1.00
R1816:Dicer1 UTSW 12 104,688,410 (GRCm39) missense probably damaging 1.00
R1927:Dicer1 UTSW 12 104,669,143 (GRCm39) missense possibly damaging 0.91
R2113:Dicer1 UTSW 12 104,679,473 (GRCm39) missense probably damaging 1.00
R2129:Dicer1 UTSW 12 104,688,290 (GRCm39) missense probably damaging 1.00
R2157:Dicer1 UTSW 12 104,669,208 (GRCm39) missense probably benign 0.17
R2202:Dicer1 UTSW 12 104,697,297 (GRCm39) missense possibly damaging 0.95
R2203:Dicer1 UTSW 12 104,697,297 (GRCm39) missense possibly damaging 0.95
R2243:Dicer1 UTSW 12 104,696,447 (GRCm39) missense probably damaging 0.99
R4237:Dicer1 UTSW 12 104,695,487 (GRCm39) missense possibly damaging 0.48
R4419:Dicer1 UTSW 12 104,671,373 (GRCm39) missense probably damaging 1.00
R4564:Dicer1 UTSW 12 104,671,010 (GRCm39) nonsense probably null
R4776:Dicer1 UTSW 12 104,658,705 (GRCm39) missense probably damaging 0.99
R4834:Dicer1 UTSW 12 104,662,850 (GRCm39) missense probably benign 0.44
R4904:Dicer1 UTSW 12 104,679,325 (GRCm39) missense probably benign
R5202:Dicer1 UTSW 12 104,660,990 (GRCm39) nonsense probably null
R5272:Dicer1 UTSW 12 104,670,499 (GRCm39) missense probably damaging 1.00
R5363:Dicer1 UTSW 12 104,669,410 (GRCm39) missense probably damaging 1.00
R5717:Dicer1 UTSW 12 104,671,387 (GRCm39) missense probably damaging 1.00
R6381:Dicer1 UTSW 12 104,662,721 (GRCm39) missense probably benign 0.00
R6479:Dicer1 UTSW 12 104,662,982 (GRCm39) missense probably damaging 0.97
R6956:Dicer1 UTSW 12 104,697,282 (GRCm39) missense probably damaging 1.00
R7234:Dicer1 UTSW 12 104,675,108 (GRCm39) missense probably damaging 1.00
R7401:Dicer1 UTSW 12 104,678,537 (GRCm39) missense probably benign
R7407:Dicer1 UTSW 12 104,688,610 (GRCm39) nonsense probably null
R7471:Dicer1 UTSW 12 104,660,969 (GRCm39) missense probably damaging 1.00
R7699:Dicer1 UTSW 12 104,671,429 (GRCm39) missense probably damaging 1.00
R7768:Dicer1 UTSW 12 104,672,956 (GRCm39) missense probably damaging 0.99
R7831:Dicer1 UTSW 12 104,675,059 (GRCm39) missense probably damaging 1.00
R7998:Dicer1 UTSW 12 104,670,328 (GRCm39) missense probably damaging 1.00
R8010:Dicer1 UTSW 12 104,658,391 (GRCm39) missense probably damaging 0.99
R8061:Dicer1 UTSW 12 104,669,077 (GRCm39) nonsense probably null
R8213:Dicer1 UTSW 12 104,668,952 (GRCm39) missense probably benign 0.00
R8261:Dicer1 UTSW 12 104,657,865 (GRCm39) missense probably damaging 1.00
R8419:Dicer1 UTSW 12 104,668,936 (GRCm39) missense probably benign 0.00
R8708:Dicer1 UTSW 12 104,694,704 (GRCm39) missense possibly damaging 0.65
R8851:Dicer1 UTSW 12 104,690,300 (GRCm39) missense possibly damaging 0.76
R9220:Dicer1 UTSW 12 104,679,415 (GRCm39) missense probably damaging 1.00
R9371:Dicer1 UTSW 12 104,670,991 (GRCm39) missense probably damaging 1.00
R9387:Dicer1 UTSW 12 104,695,499 (GRCm39) missense possibly damaging 0.48
R9505:Dicer1 UTSW 12 104,697,297 (GRCm39) missense possibly damaging 0.95
R9636:Dicer1 UTSW 12 104,688,406 (GRCm39) nonsense probably null
R9682:Dicer1 UTSW 12 104,672,484 (GRCm39) missense probably damaging 1.00
X0018:Dicer1 UTSW 12 104,663,193 (GRCm39) missense probably benign 0.00
Z1176:Dicer1 UTSW 12 104,697,279 (GRCm39) missense probably null 0.97
Predicted Primers PCR Primer
(F):5'- AGAGAGACACTTTCCCTGGC -3'
(R):5'- TGGTGACTCACTCATTGTGTATCC -3'

Sequencing Primer
(F):5'- ACACTTTCCCTGGCTGCCC -3'
(R):5'- TTACTTCACTAGCTGTAGACTCAC -3'
Posted On 2015-07-21