Incidental Mutation 'R4482:Tdrd9'
ID331472
Institutional Source Beutler Lab
Gene Symbol Tdrd9
Ensembl Gene ENSMUSG00000054003
Gene Nametudor domain containing 9
Synonyms
MMRRC Submission 041738-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R4482 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location111971559-112068854 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 112014501 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079009]
Predicted Effect probably null
Transcript: ENSMUST00000079009
SMART Domains Protein: ENSMUSP00000078022
Gene: ENSMUSG00000054003

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
DEXDc 132 327 5.64e-21 SMART
HELICc 404 502 3.22e-16 SMART
low complexity region 547 561 N/A INTRINSIC
HA2 565 666 1.9e-20 SMART
TUDOR 944 1003 1.52e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191808
Predicted Effect probably benign
Transcript: ENSMUST00000192125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194800
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male homozygous mice are sterile, displaying small testis, arrest of male meiosis and abnormal spermatocyte morphology. Females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik A G 11: 3,895,008 V27A possibly damaging Het
Actn3 A T 19: 4,863,408 probably null Het
Adamts20 T C 15: 94,345,920 Y642C probably damaging Het
Ankrd11 T C 8: 122,893,489 D1187G probably damaging Het
Bag4 T C 8: 25,785,044 probably benign Het
Bsn C A 9: 108,114,664 K1296N probably damaging Het
Cct5 T C 15: 31,597,569 D58G probably damaging Het
Cyp4a10 T C 4: 115,532,598 F467L probably damaging Het
Dicer1 A G 12: 104,706,277 Y904H probably damaging Het
Fam160a2 A T 7: 105,389,674 F119L probably benign Het
Fbn1 A T 2: 125,363,610 probably null Het
Git1 T A 11: 77,500,507 Y189N possibly damaging Het
Gm732 T A X: 107,946,631 L225F possibly damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Itga6 T A 2: 71,855,915 I1059N probably damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kbtbd3 A T 9: 4,331,051 Y475F probably damaging Het
Map3k6 T C 4: 133,243,399 I199T probably benign Het
Mtmr7 T C 8: 40,554,384 M503V probably benign Het
Muc4 A G 16: 32,756,701 T2192A unknown Het
Nexn T C 3: 152,242,753 E391G probably damaging Het
Olfr190 G T 16: 59,074,923 H52Q probably benign Het
Parg A G 14: 32,262,774 I254V probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pomt2 G A 12: 87,131,830 P290S probably benign Het
Rasl10a T A 11: 5,058,429 Y42N probably damaging Het
Slc4a8 C A 15: 100,810,599 F871L probably damaging Het
Trim21 G A 7: 102,563,933 Q53* probably null Het
Triobp T C 15: 78,966,563 S306P possibly damaging Het
Vasn A T 16: 4,648,326 T46S possibly damaging Het
Zfp236 A T 18: 82,644,221 F529Y probably benign Het
Other mutations in Tdrd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Tdrd9 APN 12 112040434 missense probably damaging 1.00
IGL01373:Tdrd9 APN 12 112040434 missense probably damaging 1.00
IGL01542:Tdrd9 APN 12 112046989 missense possibly damaging 0.94
IGL02967:Tdrd9 APN 12 111992488 missense possibly damaging 0.50
IGL03063:Tdrd9 APN 12 112044299 missense probably benign 0.00
IGL03107:Tdrd9 APN 12 112042840 missense probably damaging 0.98
R0433:Tdrd9 UTSW 12 112025581 nonsense probably null
R0453:Tdrd9 UTSW 12 112068239 missense probably benign
R0655:Tdrd9 UTSW 12 112040465 missense probably damaging 1.00
R0666:Tdrd9 UTSW 12 112007580 intron probably benign
R1073:Tdrd9 UTSW 12 112023259 missense probably damaging 1.00
R1280:Tdrd9 UTSW 12 112039408 missense probably damaging 1.00
R1386:Tdrd9 UTSW 12 112044804 missense probably benign 0.21
R1521:Tdrd9 UTSW 12 112036410 missense probably damaging 1.00
R1601:Tdrd9 UTSW 12 112023253 nonsense probably null
R1651:Tdrd9 UTSW 12 112024706 missense probably damaging 0.97
R1715:Tdrd9 UTSW 12 112036439 missense possibly damaging 0.62
R1854:Tdrd9 UTSW 12 112044812 missense probably damaging 1.00
R1905:Tdrd9 UTSW 12 112063627 splice site probably benign
R2386:Tdrd9 UTSW 12 112015900 missense probably damaging 1.00
R2863:Tdrd9 UTSW 12 112031261 missense probably benign
R2915:Tdrd9 UTSW 12 112040461 missense probably damaging 1.00
R2958:Tdrd9 UTSW 12 112041672 missense probably damaging 0.97
R4033:Tdrd9 UTSW 12 111992539 missense possibly damaging 0.58
R4087:Tdrd9 UTSW 12 112013486 nonsense probably null
R4237:Tdrd9 UTSW 12 112067625 nonsense probably null
R4501:Tdrd9 UTSW 12 112042809 missense probably benign 0.00
R4502:Tdrd9 UTSW 12 111993825 missense probably damaging 1.00
R4715:Tdrd9 UTSW 12 112041689 missense probably benign 0.00
R4803:Tdrd9 UTSW 12 111996835 nonsense probably null
R5218:Tdrd9 UTSW 12 112063475 intron probably benign
R5275:Tdrd9 UTSW 12 112051912 nonsense probably null
R5295:Tdrd9 UTSW 12 112051912 nonsense probably null
R5301:Tdrd9 UTSW 12 112036529 critical splice donor site probably null
R5339:Tdrd9 UTSW 12 112027122 missense probably damaging 1.00
R5500:Tdrd9 UTSW 12 112023268 missense probably benign 0.02
R5573:Tdrd9 UTSW 12 111997902 synonymous probably null
R5590:Tdrd9 UTSW 12 112051980 missense probably benign 0.01
R5891:Tdrd9 UTSW 12 112042719 missense probably damaging 1.00
R6056:Tdrd9 UTSW 12 111985041 missense probably damaging 1.00
R6057:Tdrd9 UTSW 12 112013286 missense possibly damaging 0.85
R6125:Tdrd9 UTSW 12 112068198 missense possibly damaging 0.89
R6254:Tdrd9 UTSW 12 112025900 splice site probably null
R6335:Tdrd9 UTSW 12 112041752 critical splice donor site probably null
R6345:Tdrd9 UTSW 12 112034608 missense probably damaging 0.99
R6792:Tdrd9 UTSW 12 112027113 missense probably benign 0.01
R6956:Tdrd9 UTSW 12 112036354 splice site probably benign
R6987:Tdrd9 UTSW 12 112025593 missense possibly damaging 0.82
R7090:Tdrd9 UTSW 12 111992470 missense probably benign
R7158:Tdrd9 UTSW 12 112036366 missense probably benign 0.08
R7220:Tdrd9 UTSW 12 112014454 missense probably damaging 1.00
R7478:Tdrd9 UTSW 12 111985042 missense probably damaging 1.00
R7489:Tdrd9 UTSW 12 112067637 missense probably benign 0.00
X0018:Tdrd9 UTSW 12 112039329 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- GTCGTTCTGAGCCAGTATACAC -3'
(R):5'- TGCCCTGAAATTCCCTGAC -3'

Sequencing Primer
(F):5'- CTAACTGTGCAGCAGTGT -3'
(R):5'- CCTGAAAGAAAACTTATCCTCGGTGG -3'
Posted On2015-07-21