Incidental Mutation 'R4482:Vasn'
ID331478
Institutional Source Beutler Lab
Gene Symbol Vasn
Ensembl Gene ENSMUSG00000039646
Gene Namevasorin
SynonymsATIA, Slitl2, 2610528G05Rik
MMRRC Submission 041738-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R4482 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location4639941-4650802 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4648326 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 46 (T46S)
Ref Sequence ENSEMBL: ENSMUSP00000045162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038552] [ENSMUST00000038770] [ENSMUST00000090480] [ENSMUST00000135823]
Predicted Effect probably benign
Transcript: ENSMUST00000038552
SMART Domains Protein: ENSMUSP00000048489
Gene: ENSMUSG00000039637

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
DUF1900 251 385 4.49e-60 SMART
low complexity region 427 456 N/A INTRINSIC
DUF1899 463 528 1.2e-19 SMART
WD40 531 570 3.64e-2 SMART
WD40 580 620 8.55e-8 SMART
WD40 623 662 1.16e-9 SMART
low complexity region 667 679 N/A INTRINSIC
DUF1900 718 854 6.69e-68 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000038770
AA Change: T46S

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045162
Gene: ENSMUSG00000039646
AA Change: T46S

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
LRRNT 24 57 4.05e-5 SMART
LRR_TYP 76 99 8.15e-6 SMART
LRR_TYP 100 123 6.23e-2 SMART
LRR_TYP 124 147 6.42e-4 SMART
LRR 169 192 1.99e0 SMART
low complexity region 197 206 N/A INTRINSIC
LRR 216 238 6.22e0 SMART
LRR 239 263 1.16e2 SMART
LRR 264 287 1.15e1 SMART
LRRCT 299 351 2.03e-11 SMART
EGF 409 443 2.79e-4 SMART
FN3 460 544 2.72e-3 SMART
transmembrane domain 578 600 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090480
SMART Domains Protein: ENSMUSP00000087966
Gene: ENSMUSG00000039637

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130125
Predicted Effect probably benign
Transcript: ENSMUST00000135823
SMART Domains Protein: ENSMUSP00000118310
Gene: ENSMUSG00000039637

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144815
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit increased sensitivity to TNFalpha-induced lethality, TNFalpha-, cycloheximide-, or CoCl2-induced cell death, and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik A G 11: 3,895,008 V27A possibly damaging Het
Actn3 A T 19: 4,863,408 probably null Het
Adamts20 T C 15: 94,345,920 Y642C probably damaging Het
Ankrd11 T C 8: 122,893,489 D1187G probably damaging Het
Bag4 T C 8: 25,785,044 probably benign Het
Bsn C A 9: 108,114,664 K1296N probably damaging Het
Cct5 T C 15: 31,597,569 D58G probably damaging Het
Cyp4a10 T C 4: 115,532,598 F467L probably damaging Het
Dicer1 A G 12: 104,706,277 Y904H probably damaging Het
Fam160a2 A T 7: 105,389,674 F119L probably benign Het
Fbn1 A T 2: 125,363,610 probably null Het
Git1 T A 11: 77,500,507 Y189N possibly damaging Het
Gm732 T A X: 107,946,631 L225F possibly damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Itga6 T A 2: 71,855,915 I1059N probably damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kbtbd3 A T 9: 4,331,051 Y475F probably damaging Het
Map3k6 T C 4: 133,243,399 I199T probably benign Het
Mtmr7 T C 8: 40,554,384 M503V probably benign Het
Muc4 A G 16: 32,756,701 T2192A unknown Het
Nexn T C 3: 152,242,753 E391G probably damaging Het
Olfr190 G T 16: 59,074,923 H52Q probably benign Het
Parg A G 14: 32,262,774 I254V probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pomt2 G A 12: 87,131,830 P290S probably benign Het
Rasl10a T A 11: 5,058,429 Y42N probably damaging Het
Slc4a8 C A 15: 100,810,599 F871L probably damaging Het
Tdrd9 T C 12: 112,014,501 probably null Het
Trim21 G A 7: 102,563,933 Q53* probably null Het
Triobp T C 15: 78,966,563 S306P possibly damaging Het
Zfp236 A T 18: 82,644,221 F529Y probably benign Het
Other mutations in Vasn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Vasn APN 16 4648368 missense probably benign 0.00
IGL01543:Vasn APN 16 4649892 missense possibly damaging 0.60
PIT4243001:Vasn UTSW 16 4649616 missense probably damaging 1.00
PIT4810001:Vasn UTSW 16 4650045 missense probably benign
R1394:Vasn UTSW 16 4649712 nonsense probably null
R1459:Vasn UTSW 16 4648609 unclassified probably null
R2136:Vasn UTSW 16 4649795 nonsense probably null
R5423:Vasn UTSW 16 4648420 missense probably benign 0.01
R5733:Vasn UTSW 16 4650162 missense possibly damaging 0.93
R7230:Vasn UTSW 16 4649622 missense probably benign 0.10
R7507:Vasn UTSW 16 4649481 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCAGCCCTGACTCATAAG -3'
(R):5'- TCTCGTTGGAGATCTCGTGC -3'

Sequencing Primer
(F):5'- GCTCTTTGCTCTTAGGGACAGAAG -3'
(R):5'- CAGTCAGGTCCAGGTTACTG -3'
Posted On2015-07-21