Incidental Mutation 'R4482:Olfr190'
ID331481
Institutional Source Beutler Lab
Gene Symbol Olfr190
Ensembl Gene ENSMUSG00000064006
Gene Nameolfactory receptor 190
SynonymsMOR183-4, GA_x54KRFPKG5P-55303207-55302284
MMRRC Submission 041738-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R4482 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location59067140-59078005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 59074923 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 52 (H52Q)
Ref Sequence ENSEMBL: ENSMUSP00000148991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071243] [ENSMUST00000206214] [ENSMUST00000215687] [ENSMUST00000216495]
Predicted Effect probably benign
Transcript: ENSMUST00000071243
AA Change: H52Q

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000071224
Gene: ENSMUSG00000064006
AA Change: H52Q

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.1e-46 PFAM
Pfam:7tm_1 39 288 2.8e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206214
AA Change: H52Q
Predicted Effect probably benign
Transcript: ENSMUST00000215687
AA Change: H52Q

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000216495
AA Change: H52Q

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik A G 11: 3,895,008 V27A possibly damaging Het
Actn3 A T 19: 4,863,408 probably null Het
Adamts20 T C 15: 94,345,920 Y642C probably damaging Het
Ankrd11 T C 8: 122,893,489 D1187G probably damaging Het
Bag4 T C 8: 25,785,044 probably benign Het
Bsn C A 9: 108,114,664 K1296N probably damaging Het
Cct5 T C 15: 31,597,569 D58G probably damaging Het
Cyp4a10 T C 4: 115,532,598 F467L probably damaging Het
Dicer1 A G 12: 104,706,277 Y904H probably damaging Het
Fam160a2 A T 7: 105,389,674 F119L probably benign Het
Fbn1 A T 2: 125,363,610 probably null Het
Git1 T A 11: 77,500,507 Y189N possibly damaging Het
Gm732 T A X: 107,946,631 L225F possibly damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Itga6 T A 2: 71,855,915 I1059N probably damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kbtbd3 A T 9: 4,331,051 Y475F probably damaging Het
Map3k6 T C 4: 133,243,399 I199T probably benign Het
Mtmr7 T C 8: 40,554,384 M503V probably benign Het
Muc4 A G 16: 32,756,701 T2192A unknown Het
Nexn T C 3: 152,242,753 E391G probably damaging Het
Parg A G 14: 32,262,774 I254V probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pomt2 G A 12: 87,131,830 P290S probably benign Het
Rasl10a T A 11: 5,058,429 Y42N probably damaging Het
Slc4a8 C A 15: 100,810,599 F871L probably damaging Het
Tdrd9 T C 12: 112,014,501 probably null Het
Trim21 G A 7: 102,563,933 Q53* probably null Het
Triobp T C 15: 78,966,563 S306P possibly damaging Het
Vasn A T 16: 4,648,326 T46S possibly damaging Het
Zfp236 A T 18: 82,644,221 F529Y probably benign Het
Other mutations in Olfr190
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Olfr190 APN 16 59074689 nonsense probably null
IGL01011:Olfr190 APN 16 59074430 missense probably benign 0.10
IGL01453:Olfr190 APN 16 59074769 missense probably benign 0.00
IGL01978:Olfr190 APN 16 59074267 missense probably benign 0.33
IGL02348:Olfr190 APN 16 59074949 missense probably damaging 0.99
IGL02423:Olfr190 APN 16 59074267 missense probably benign 0.33
IGL02628:Olfr190 APN 16 59074792 missense probably benign 0.01
R0220:Olfr190 UTSW 16 59074732 missense probably damaging 1.00
R0471:Olfr190 UTSW 16 59074270 missense probably benign 0.01
R1697:Olfr190 UTSW 16 59074907 missense probably damaging 1.00
R3009:Olfr190 UTSW 16 59074987 missense probably benign 0.01
R3011:Olfr190 UTSW 16 59074987 missense probably benign 0.01
R3027:Olfr190 UTSW 16 59074967 missense probably benign 0.00
R4080:Olfr190 UTSW 16 59074256 missense probably damaging 0.96
R4895:Olfr190 UTSW 16 59074657 missense probably benign 0.09
R5409:Olfr190 UTSW 16 59074196 missense possibly damaging 0.94
R5825:Olfr190 UTSW 16 59074661 missense probably benign 0.01
R6146:Olfr190 UTSW 16 59074714 missense probably benign 0.05
R6249:Olfr190 UTSW 16 59074432 missense probably damaging 1.00
R6996:Olfr190 UTSW 16 59074192 missense probably benign 0.00
R7283:Olfr190 UTSW 16 59074192 missense probably benign
R7707:Olfr190 UTSW 16 59074271 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CCAACAAGAAACATTCTGTAGTAGC -3'
(R):5'- ACATGGTATCAAATGTACTCTCCTG -3'

Sequencing Primer
(F):5'- GAAACATTCTGTAGTAGCACAGATTG -3'
(R):5'- TTGTTTCAGTGATTATCCATTGAGG -3'
Posted On2015-07-21