Incidental Mutation 'R4482:Actn3'
ID331483
Institutional Source Beutler Lab
Gene Symbol Actn3
Ensembl Gene ENSMUSG00000006457
Gene Nameactinin alpha 3
Synonyms
MMRRC Submission 041738-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.401) question?
Stock #R4482 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location4861223-4877909 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 4863408 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000006626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006626] [ENSMUST00000006626] [ENSMUST00000119694]
Predicted Effect probably null
Transcript: ENSMUST00000006626
SMART Domains Protein: ENSMUSP00000006626
Gene: ENSMUSG00000006457

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
CH 46 146 1.4e-23 SMART
CH 159 258 4.83e-27 SMART
low complexity region 261 272 N/A INTRINSIC
Pfam:Spectrin 287 397 5.5e-15 PFAM
SPEC 410 511 3.78e-23 SMART
SPEC 525 632 2.37e-6 SMART
Pfam:Spectrin 643 746 4.1e-15 PFAM
EFh 763 791 7.93e-1 SMART
EFh 799 827 5.96e-1 SMART
efhand_Ca_insen 830 896 2.29e-34 SMART
Predicted Effect probably null
Transcript: ENSMUST00000006626
SMART Domains Protein: ENSMUSP00000006626
Gene: ENSMUSG00000006457

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
CH 46 146 1.4e-23 SMART
CH 159 258 4.83e-27 SMART
low complexity region 261 272 N/A INTRINSIC
Pfam:Spectrin 287 397 5.5e-15 PFAM
SPEC 410 511 3.78e-23 SMART
SPEC 525 632 2.37e-6 SMART
Pfam:Spectrin 643 746 4.1e-15 PFAM
EFh 763 791 7.93e-1 SMART
EFh 799 827 5.96e-1 SMART
efhand_Ca_insen 830 896 2.29e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119694
SMART Domains Protein: ENSMUSP00000112481
Gene: ENSMUSG00000083282

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 55 77 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
Inhibitor_I29 165 222 5.41e-16 SMART
Pept_C1 249 460 4.2e-93 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138811
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the alpha-actin binding protein gene family. The encoded protein is primarily expressed in skeletal muscle and functions as a structural component of sarcomeric Z line. This protein is involved in crosslinking actin containing thin filaments. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit an increase mitochondria density and a shift from anaerobic to aerobic metabolism in fast muscle fiber that is associated with increased aerobic capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik A G 11: 3,895,008 V27A possibly damaging Het
Adamts20 T C 15: 94,345,920 Y642C probably damaging Het
Ankrd11 T C 8: 122,893,489 D1187G probably damaging Het
Bag4 T C 8: 25,785,044 probably benign Het
Bsn C A 9: 108,114,664 K1296N probably damaging Het
Cct5 T C 15: 31,597,569 D58G probably damaging Het
Cyp4a10 T C 4: 115,532,598 F467L probably damaging Het
Dicer1 A G 12: 104,706,277 Y904H probably damaging Het
Fam160a2 A T 7: 105,389,674 F119L probably benign Het
Fbn1 A T 2: 125,363,610 probably null Het
Git1 T A 11: 77,500,507 Y189N possibly damaging Het
Gm732 T A X: 107,946,631 L225F possibly damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Itga6 T A 2: 71,855,915 I1059N probably damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kbtbd3 A T 9: 4,331,051 Y475F probably damaging Het
Map3k6 T C 4: 133,243,399 I199T probably benign Het
Mtmr7 T C 8: 40,554,384 M503V probably benign Het
Muc4 A G 16: 32,756,701 T2192A unknown Het
Nexn T C 3: 152,242,753 E391G probably damaging Het
Olfr190 G T 16: 59,074,923 H52Q probably benign Het
Parg A G 14: 32,262,774 I254V probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pomt2 G A 12: 87,131,830 P290S probably benign Het
Rasl10a T A 11: 5,058,429 Y42N probably damaging Het
Slc4a8 C A 15: 100,810,599 F871L probably damaging Het
Tdrd9 T C 12: 112,014,501 probably null Het
Trim21 G A 7: 102,563,933 Q53* probably null Het
Triobp T C 15: 78,966,563 S306P possibly damaging Het
Vasn A T 16: 4,648,326 T46S possibly damaging Het
Zfp236 A T 18: 82,644,221 F529Y probably benign Het
Other mutations in Actn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
ballooned UTSW 19 4871848 missense probably damaging 1.00
PIT4480001:Actn3 UTSW 19 4867577 nonsense probably null
R0128:Actn3 UTSW 19 4871615 missense probably damaging 1.00
R1174:Actn3 UTSW 19 4864756 missense probably damaging 1.00
R1181:Actn3 UTSW 19 4872610 missense probably benign 0.07
R1239:Actn3 UTSW 19 4865455 unclassified probably benign
R1445:Actn3 UTSW 19 4865455 unclassified probably benign
R1698:Actn3 UTSW 19 4862207 missense possibly damaging 0.55
R2127:Actn3 UTSW 19 4871675 missense probably damaging 1.00
R4017:Actn3 UTSW 19 4867546 missense possibly damaging 0.95
R4293:Actn3 UTSW 19 4865440 missense probably benign 0.09
R4840:Actn3 UTSW 19 4864511 missense probably damaging 1.00
R4868:Actn3 UTSW 19 4864454 missense probably benign 0.24
R5152:Actn3 UTSW 19 4863544 missense probably damaging 1.00
R5349:Actn3 UTSW 19 4867958 missense possibly damaging 0.94
R5420:Actn3 UTSW 19 4865344 frame shift probably null
R5448:Actn3 UTSW 19 4863211 missense possibly damaging 0.94
R5563:Actn3 UTSW 19 4872316 missense probably damaging 1.00
R5753:Actn3 UTSW 19 4864567 critical splice acceptor site probably null
R6457:Actn3 UTSW 19 4871848 missense probably damaging 1.00
R7236:Actn3 UTSW 19 4871616 missense probably benign 0.07
R7470:Actn3 UTSW 19 4867814 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AAGACTAGGCTCTCCTGCAG -3'
(R):5'- ACAGTTGGCTATGATATGACCACTC -3'

Sequencing Primer
(F):5'- AGCCGGTCGATGTTGCTC -3'
(R):5'- TCTCCTTCCCAGGTCAGAAAG -3'
Posted On2015-07-21