Incidental Mutation 'R4482:Gm732'
ID331484
Institutional Source Beutler Lab
Gene Symbol Gm732
Ensembl Gene ENSMUSG00000073006
Gene Namepredicted gene 732
SynonymsLOC213450
MMRRC Submission 041738-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R4482 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location107945735-107948465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107946631 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 225 (L225F)
Ref Sequence ENSEMBL: ENSMUSP00000098848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101290] [ENSMUST00000155294]
Predicted Effect possibly damaging
Transcript: ENSMUST00000101290
AA Change: L225F

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098848
Gene: ENSMUSG00000073006
AA Change: L225F

DomainStartEndE-ValueType
low complexity region 203 219 N/A INTRINSIC
low complexity region 306 323 N/A INTRINSIC
low complexity region 411 429 N/A INTRINSIC
WH2 461 478 1.7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155294
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik A G 11: 3,895,008 V27A possibly damaging Het
Actn3 A T 19: 4,863,408 probably null Het
Adamts20 T C 15: 94,345,920 Y642C probably damaging Het
Ankrd11 T C 8: 122,893,489 D1187G probably damaging Het
Bag4 T C 8: 25,785,044 probably benign Het
Bsn C A 9: 108,114,664 K1296N probably damaging Het
Cct5 T C 15: 31,597,569 D58G probably damaging Het
Cyp4a10 T C 4: 115,532,598 F467L probably damaging Het
Dicer1 A G 12: 104,706,277 Y904H probably damaging Het
Fam160a2 A T 7: 105,389,674 F119L probably benign Het
Fbn1 A T 2: 125,363,610 probably null Het
Git1 T A 11: 77,500,507 Y189N possibly damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Itga6 T A 2: 71,855,915 I1059N probably damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kbtbd3 A T 9: 4,331,051 Y475F probably damaging Het
Map3k6 T C 4: 133,243,399 I199T probably benign Het
Mtmr7 T C 8: 40,554,384 M503V probably benign Het
Muc4 A G 16: 32,756,701 T2192A unknown Het
Nexn T C 3: 152,242,753 E391G probably damaging Het
Olfr190 G T 16: 59,074,923 H52Q probably benign Het
Parg A G 14: 32,262,774 I254V probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pomt2 G A 12: 87,131,830 P290S probably benign Het
Rasl10a T A 11: 5,058,429 Y42N probably damaging Het
Slc4a8 C A 15: 100,810,599 F871L probably damaging Het
Tdrd9 T C 12: 112,014,501 probably null Het
Trim21 G A 7: 102,563,933 Q53* probably null Het
Triobp T C 15: 78,966,563 S306P possibly damaging Het
Vasn A T 16: 4,648,326 T46S possibly damaging Het
Zfp236 A T 18: 82,644,221 F529Y probably benign Het
Other mutations in Gm732
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Gm732 APN X 107947196 missense possibly damaging 0.94
IGL00928:Gm732 APN X 107945843 missense possibly damaging 0.87
X0010:Gm732 UTSW X 107946800 missense probably benign 0.00
X0011:Gm732 UTSW X 107945849 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCACAATTGAATCCCATGACTG -3'
(R):5'- TGCTTAGGCAAGGACCAACTC -3'

Sequencing Primer
(F):5'- ACCCTGTGGATTTAGACC -3'
(R):5'- CTCTGGCTCATTACAAATCCAATG -3'
Posted On2015-07-21