Incidental Mutation 'R4483:Cep350'
ID 331486
Institutional Source Beutler Lab
Gene Symbol Cep350
Ensembl Gene ENSMUSG00000033671
Gene Name centrosomal protein 350
Synonyms 4933409L06Rik, 6430546F08Rik
MMRRC Submission 041739-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.961) question?
Stock # R4483 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 155720710-155849001 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 155802214 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1104 (V1104A)
Ref Sequence ENSEMBL: ENSMUSP00000120085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138762]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000138762
AA Change: V1104A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000120085
Gene: ENSMUSG00000033671
AA Change: V1104A

DomainStartEndE-ValueType
low complexity region 251 265 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 481 491 N/A INTRINSIC
coiled coil region 596 641 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 979 994 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1250 1267 N/A INTRINSIC
coiled coil region 1363 1402 N/A INTRINSIC
low complexity region 1517 1531 N/A INTRINSIC
low complexity region 1536 1546 N/A INTRINSIC
low complexity region 1694 1714 N/A INTRINSIC
coiled coil region 1732 1794 N/A INTRINSIC
low complexity region 1800 1811 N/A INTRINSIC
low complexity region 1819 1835 N/A INTRINSIC
coiled coil region 1853 1893 N/A INTRINSIC
low complexity region 1980 1994 N/A INTRINSIC
coiled coil region 2042 2092 N/A INTRINSIC
low complexity region 2383 2394 N/A INTRINSIC
low complexity region 2409 2421 N/A INTRINSIC
low complexity region 2470 2482 N/A INTRINSIC
CAP_GLY 2486 2551 5.91e-31 SMART
coiled coil region 2700 2731 N/A INTRINSIC
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a large protein with a CAP-Gly domain typically found in cytoskeleton-associated proteins. The encoded protein primarily localizes to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. The encoded protein directly interacts with another large centrosomal protein and is required to anchor microtubules at the centrosome. It is also implicated in the regulation of a class of nuclear hormone receptors in the nucleus. Several alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

 All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,567,349 (GRCm39) G5275S probably benign Het
Akap11 A G 14: 78,747,699 (GRCm39) S1563P probably damaging Het
Ankrd50 A G 3: 38,511,680 (GRCm39) V229A probably damaging Het
AW112010 A G 19: 11,027,757 (GRCm39) noncoding transcript Het
Ccdc158 A G 5: 92,781,187 (GRCm39) S873P probably benign Het
Chil4 G A 3: 106,121,678 (GRCm39) A57V probably damaging Het
Cpa5 A G 6: 30,624,625 (GRCm39) E155G probably damaging Het
Ctsq T C 13: 61,186,726 (GRCm39) I93V probably benign Het
Dbi A T 1: 120,048,535 (GRCm39) I37K probably benign Het
Defa35 T C 8: 21,555,208 (GRCm39) S43P probably damaging Het
Fance T A 17: 28,534,781 (GRCm39) probably benign Het
Fbxl6 A G 15: 76,422,129 (GRCm39) L180P probably damaging Het
Fkbpl T C 17: 34,865,269 (GRCm39) F346L probably damaging Het
Gm11735 C A 11: 116,632,101 (GRCm39) noncoding transcript Het
Gm28042 T C 2: 119,866,321 (GRCm39) I373T possibly damaging Het
Golga4 T C 9: 118,343,254 (GRCm39) S27P probably damaging Het
Gstm1 C T 3: 107,923,834 (GRCm39) probably null Het
Lama3 T A 18: 12,682,310 (GRCm39) I1092K probably benign Het
Med15 A T 16: 17,489,428 (GRCm39) probably benign Het
Nlrp6 A G 7: 140,501,694 (GRCm39) D87G probably damaging Het
Parp11 A G 6: 127,448,568 (GRCm39) T62A probably benign Het
Pcnt A G 10: 76,237,317 (GRCm39) L1323S probably damaging Het
Ppp2r1a C T 17: 21,176,072 (GRCm39) T98I probably benign Het
Pramel11 T A 4: 143,622,410 (GRCm39) Y315F probably damaging Het
Prl7a2 T A 13: 27,844,930 (GRCm39) H152L possibly damaging Het
Rnf145 T C 11: 44,455,104 (GRCm39) S662P probably benign Het
Rpl31-ps17 C T 12: 54,748,397 (GRCm39) noncoding transcript Het
Tnfaip3 A T 10: 18,887,375 (GRCm39) M50K probably damaging Het
Txlnb T TTA 10: 17,714,745 (GRCm39) probably null Het
Usp9x A G X: 12,987,687 (GRCm39) D638G possibly damaging Het
Vmn1r30 A T 6: 58,412,118 (GRCm39) V238E probably damaging Het
Zfp507 A G 7: 35,487,141 (GRCm39) probably null Het
Zfp532 G T 18: 65,789,636 (GRCm39) W1025L probably benign Het
Other mutations in Cep350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Cep350 APN 1 155,816,492 (GRCm39) missense possibly damaging 0.68
IGL00821:Cep350 APN 1 155,737,950 (GRCm39) missense probably benign
IGL00837:Cep350 APN 1 155,829,137 (GRCm39) missense probably damaging 1.00
IGL00977:Cep350 APN 1 155,808,611 (GRCm39) missense probably null 0.99
IGL01544:Cep350 APN 1 155,828,933 (GRCm39) missense probably damaging 1.00
IGL01616:Cep350 APN 1 155,828,993 (GRCm39) missense probably benign 0.00
IGL01695:Cep350 APN 1 155,819,904 (GRCm39) missense probably damaging 1.00
IGL01902:Cep350 APN 1 155,737,731 (GRCm39) missense probably damaging 1.00
IGL01977:Cep350 APN 1 155,787,714 (GRCm39) missense probably benign 0.01
IGL02388:Cep350 APN 1 155,829,499 (GRCm39) missense probably benign 0.28
IGL02475:Cep350 APN 1 155,738,341 (GRCm39) missense probably damaging 1.00
IGL02528:Cep350 APN 1 155,770,361 (GRCm39) missense probably damaging 1.00
IGL02598:Cep350 APN 1 155,738,713 (GRCm39) missense probably benign 0.00
IGL02676:Cep350 APN 1 155,737,977 (GRCm39) missense possibly damaging 0.82
IGL02728:Cep350 APN 1 155,828,968 (GRCm39) missense probably benign 0.02
IGL02744:Cep350 APN 1 155,807,279 (GRCm39) missense probably damaging 0.98
IGL02817:Cep350 APN 1 155,804,588 (GRCm39) missense probably damaging 1.00
IGL02892:Cep350 APN 1 155,744,552 (GRCm39) missense possibly damaging 0.51
IGL03156:Cep350 APN 1 155,733,788 (GRCm39) missense probably damaging 1.00
IGL03166:Cep350 APN 1 155,739,346 (GRCm39) missense possibly damaging 0.78
IGL03216:Cep350 APN 1 155,736,373 (GRCm39) missense probably benign 0.06
IGL03268:Cep350 APN 1 155,829,295 (GRCm39) missense probably benign 0.16
IGL03358:Cep350 APN 1 155,804,285 (GRCm39) missense probably benign
primed UTSW 1 155,829,334 (GRCm39) missense probably damaging 0.98
stoked UTSW 1 155,791,321 (GRCm39) missense probably benign 0.03
NA:Cep350 UTSW 1 155,834,394 (GRCm39) missense probably damaging 1.00
R0060:Cep350 UTSW 1 155,804,372 (GRCm39) missense probably damaging 1.00
R0060:Cep350 UTSW 1 155,804,372 (GRCm39) missense probably damaging 1.00
R0066:Cep350 UTSW 1 155,786,964 (GRCm39) missense probably damaging 0.99
R0066:Cep350 UTSW 1 155,786,964 (GRCm39) missense probably damaging 0.99
R0172:Cep350 UTSW 1 155,829,193 (GRCm39) missense probably benign 0.00
R0365:Cep350 UTSW 1 155,782,317 (GRCm39) missense probably benign 0.00
R0472:Cep350 UTSW 1 155,790,469 (GRCm39) missense probably damaging 0.99
R0502:Cep350 UTSW 1 155,776,629 (GRCm39) splice site probably null
R0538:Cep350 UTSW 1 155,724,366 (GRCm39) missense possibly damaging 0.80
R0547:Cep350 UTSW 1 155,777,181 (GRCm39) splice site probably null
R0565:Cep350 UTSW 1 155,836,941 (GRCm39) splice site probably benign
R0607:Cep350 UTSW 1 155,747,794 (GRCm39) missense probably damaging 1.00
R0645:Cep350 UTSW 1 155,816,458 (GRCm39) splice site probably null
R0675:Cep350 UTSW 1 155,835,499 (GRCm39) missense possibly damaging 0.63
R0828:Cep350 UTSW 1 155,828,992 (GRCm39) missense probably benign 0.00
R0863:Cep350 UTSW 1 155,737,981 (GRCm39) missense probably benign 0.00
R0969:Cep350 UTSW 1 155,816,572 (GRCm39) missense possibly damaging 0.81
R1102:Cep350 UTSW 1 155,807,264 (GRCm39) missense probably damaging 1.00
R1186:Cep350 UTSW 1 155,751,122 (GRCm39) missense probably damaging 1.00
R1552:Cep350 UTSW 1 155,786,484 (GRCm39) missense possibly damaging 0.92
R1560:Cep350 UTSW 1 155,804,825 (GRCm39) missense possibly damaging 0.48
R1698:Cep350 UTSW 1 155,829,104 (GRCm39) missense possibly damaging 0.62
R1729:Cep350 UTSW 1 155,787,727 (GRCm39) missense probably benign 0.17
R1735:Cep350 UTSW 1 155,828,960 (GRCm39) missense probably damaging 0.99
R1740:Cep350 UTSW 1 155,804,579 (GRCm39) missense probably damaging 1.00
R1783:Cep350 UTSW 1 155,804,611 (GRCm39) missense probably damaging 1.00
R1844:Cep350 UTSW 1 155,724,374 (GRCm39) missense probably damaging 0.99
R1848:Cep350 UTSW 1 155,829,397 (GRCm39) missense probably benign 0.28
R1988:Cep350 UTSW 1 155,808,850 (GRCm39) missense possibly damaging 0.82
R2008:Cep350 UTSW 1 155,790,467 (GRCm39) missense probably benign 0.16
R2241:Cep350 UTSW 1 155,834,302 (GRCm39) splice site probably null
R2245:Cep350 UTSW 1 155,754,766 (GRCm39) missense probably benign 0.10
R2402:Cep350 UTSW 1 155,738,882 (GRCm39) missense probably benign
R2566:Cep350 UTSW 1 155,835,464 (GRCm39) critical splice donor site probably null
R3160:Cep350 UTSW 1 155,738,910 (GRCm39) missense probably benign 0.00
R3162:Cep350 UTSW 1 155,738,910 (GRCm39) missense probably benign 0.00
R3769:Cep350 UTSW 1 155,828,950 (GRCm39) missense probably damaging 1.00
R4035:Cep350 UTSW 1 155,835,541 (GRCm39) missense probably benign 0.06
R4158:Cep350 UTSW 1 155,808,621 (GRCm39) missense probably damaging 1.00
R4160:Cep350 UTSW 1 155,808,621 (GRCm39) missense probably damaging 1.00
R4213:Cep350 UTSW 1 155,811,707 (GRCm39) missense probably damaging 1.00
R4648:Cep350 UTSW 1 155,778,344 (GRCm39) missense possibly damaging 0.85
R4694:Cep350 UTSW 1 155,804,332 (GRCm39) missense probably damaging 1.00
R4836:Cep350 UTSW 1 155,804,579 (GRCm39) missense probably damaging 1.00
R4839:Cep350 UTSW 1 155,804,240 (GRCm39) missense probably benign 0.00
R4969:Cep350 UTSW 1 155,736,025 (GRCm39) missense probably damaging 0.99
R5014:Cep350 UTSW 1 155,803,952 (GRCm39) missense probably benign 0.00
R5027:Cep350 UTSW 1 155,809,100 (GRCm39) missense probably benign 0.01
R5144:Cep350 UTSW 1 155,786,896 (GRCm39) missense probably damaging 0.99
R5153:Cep350 UTSW 1 155,811,692 (GRCm39) missense probably damaging 1.00
R5165:Cep350 UTSW 1 155,804,114 (GRCm39) missense probably damaging 1.00
R5182:Cep350 UTSW 1 155,733,854 (GRCm39) missense probably damaging 1.00
R5445:Cep350 UTSW 1 155,770,469 (GRCm39) missense probably benign 0.01
R5738:Cep350 UTSW 1 155,741,824 (GRCm39) missense probably damaging 1.00
R5809:Cep350 UTSW 1 155,809,087 (GRCm39) missense probably damaging 0.98
R5855:Cep350 UTSW 1 155,829,508 (GRCm39) missense probably benign 0.00
R6103:Cep350 UTSW 1 155,800,322 (GRCm39) missense probably benign 0.05
R6139:Cep350 UTSW 1 155,829,025 (GRCm39) missense probably benign 0.03
R6285:Cep350 UTSW 1 155,829,120 (GRCm39) missense possibly damaging 0.48
R6430:Cep350 UTSW 1 155,770,419 (GRCm39) missense probably damaging 1.00
R6446:Cep350 UTSW 1 155,737,900 (GRCm39) missense probably benign
R6520:Cep350 UTSW 1 155,809,082 (GRCm39) missense probably benign 0.02
R6712:Cep350 UTSW 1 155,733,852 (GRCm39) missense possibly damaging 0.93
R6940:Cep350 UTSW 1 155,804,297 (GRCm39) missense probably benign 0.01
R7020:Cep350 UTSW 1 155,804,077 (GRCm39) missense probably damaging 1.00
R7056:Cep350 UTSW 1 155,724,373 (GRCm39) missense probably damaging 1.00
R7141:Cep350 UTSW 1 155,790,494 (GRCm39) missense probably damaging 1.00
R7215:Cep350 UTSW 1 155,770,453 (GRCm39) missense possibly damaging 0.89
R7247:Cep350 UTSW 1 155,786,499 (GRCm39) missense probably damaging 1.00
R7272:Cep350 UTSW 1 155,829,334 (GRCm39) missense probably damaging 0.98
R7336:Cep350 UTSW 1 155,738,022 (GRCm39) missense probably benign 0.17
R7361:Cep350 UTSW 1 155,777,237 (GRCm39) missense probably damaging 1.00
R7390:Cep350 UTSW 1 155,741,833 (GRCm39) missense possibly damaging 0.94
R7402:Cep350 UTSW 1 155,803,961 (GRCm39) missense probably benign 0.00
R7428:Cep350 UTSW 1 155,770,365 (GRCm39) missense probably benign 0.00
R7440:Cep350 UTSW 1 155,816,518 (GRCm39) missense probably damaging 0.98
R7520:Cep350 UTSW 1 155,791,375 (GRCm39) missense probably benign 0.05
R7529:Cep350 UTSW 1 155,737,669 (GRCm39) missense probably benign 0.08
R7635:Cep350 UTSW 1 155,754,767 (GRCm39) nonsense probably null
R7806:Cep350 UTSW 1 155,737,809 (GRCm39) missense probably benign 0.00
R8100:Cep350 UTSW 1 155,829,148 (GRCm39) missense probably damaging 0.97
R8192:Cep350 UTSW 1 155,816,529 (GRCm39) missense possibly damaging 0.94
R8193:Cep350 UTSW 1 155,737,825 (GRCm39) missense probably benign 0.01
R8351:Cep350 UTSW 1 155,747,780 (GRCm39) missense probably damaging 0.99
R8406:Cep350 UTSW 1 155,798,164 (GRCm39) missense probably benign 0.00
R8451:Cep350 UTSW 1 155,747,780 (GRCm39) missense probably damaging 0.99
R8467:Cep350 UTSW 1 155,791,321 (GRCm39) missense probably benign 0.03
R8543:Cep350 UTSW 1 155,738,122 (GRCm39) missense probably damaging 0.98
R8714:Cep350 UTSW 1 155,736,477 (GRCm39) missense probably damaging 0.98
R8810:Cep350 UTSW 1 155,803,862 (GRCm39) missense probably damaging 1.00
R8837:Cep350 UTSW 1 155,737,518 (GRCm39) missense probably benign 0.09
R8933:Cep350 UTSW 1 155,739,161 (GRCm39) missense probably benign 0.01
R9043:Cep350 UTSW 1 155,773,228 (GRCm39) missense probably damaging 1.00
R9050:Cep350 UTSW 1 155,738,687 (GRCm39) missense possibly damaging 0.81
R9067:Cep350 UTSW 1 155,737,485 (GRCm39) missense probably benign 0.00
R9105:Cep350 UTSW 1 155,835,561 (GRCm39) missense probably damaging 1.00
R9295:Cep350 UTSW 1 155,738,051 (GRCm39) nonsense probably null
R9304:Cep350 UTSW 1 155,829,464 (GRCm39) missense probably damaging 0.98
R9456:Cep350 UTSW 1 155,744,457 (GRCm39) missense probably benign 0.00
R9575:Cep350 UTSW 1 155,751,113 (GRCm39) missense probably benign 0.03
R9715:Cep350 UTSW 1 155,751,107 (GRCm39) missense probably benign 0.00
R9749:Cep350 UTSW 1 155,828,985 (GRCm39) missense probably benign 0.02
R9758:Cep350 UTSW 1 155,770,433 (GRCm39) missense probably damaging 0.96
R9767:Cep350 UTSW 1 155,739,018 (GRCm39) missense probably benign 0.01
RF020:Cep350 UTSW 1 155,791,224 (GRCm39) missense probably benign 0.34
X0018:Cep350 UTSW 1 155,829,032 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ACTATCAAGTCAGCTCAGGC -3'
(R):5'- AAGCAAATGAAAGAATCCCTTGT -3'

Sequencing Primer
(F):5'- TATCAAGTCAGCTCAGGCAGTCTG -3'
(R):5'- GCAAATGAAAGAATCCCTTGTTTATG -3'
Posted On 2015-07-21