Mutagenetix > Incidental Mutation

Incidental Mutation 'R4483:Cep350'

331486

Institutional Source

Beutler Lab

Gene Symbol

Cep350

Ensembl Gene

ENSMUSG00000033671

Gene Name

centrosomal protein 350

Synonyms

6430546F08Rik, 4933409L06Rik

MMRRC Submission

041739-MU

Accession Numbers

Genbank: NM_001039184.1; Ensembl: ENSMUST00000138762, ENSMUST00000124495, ENSMUST00000078888

Essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R4483 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

155844964-155973255 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 155926468 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1104 (V1104A)

Ref Sequence

ENSEMBL: ENSMUSP00000120085 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000138762]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000138762
AA Change: V1104A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000120085
Gene: ENSMUSG00000033671
AA Change: V1104A

Domain	Start	End	E-Value	Type
low complexity region	251	265	N/A	INTRINSIC
low complexity region	376	394	N/A	INTRINSIC
low complexity region	481	491	N/A	INTRINSIC
coiled coil region	596	641	N/A	INTRINSIC
low complexity region	659	669	N/A	INTRINSIC
low complexity region	701	719	N/A	INTRINSIC
low complexity region	754	763	N/A	INTRINSIC
low complexity region	979	994	N/A	INTRINSIC
low complexity region	1153	1175	N/A	INTRINSIC
low complexity region	1250	1267	N/A	INTRINSIC
coiled coil region	1363	1402	N/A	INTRINSIC
low complexity region	1517	1531	N/A	INTRINSIC
low complexity region	1536	1546	N/A	INTRINSIC
low complexity region	1694	1714	N/A	INTRINSIC
coiled coil region	1732	1794	N/A	INTRINSIC
low complexity region	1800	1811	N/A	INTRINSIC
low complexity region	1819	1835	N/A	INTRINSIC
coiled coil region	1853	1893	N/A	INTRINSIC
low complexity region	1980	1994	N/A	INTRINSIC
coiled coil region	2042	2092	N/A	INTRINSIC
low complexity region	2383	2394	N/A	INTRINSIC
low complexity region	2409	2421	N/A	INTRINSIC
low complexity region	2470	2482	N/A	INTRINSIC
CAP_GLY	2486	2551	5.91e-31	SMART
coiled coil region	2700	2731	N/A	INTRINSIC

Meta Mutation Damage Score

0.0584

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a large protein with a CAP-Gly domain typically found in cytoskeleton-associated proteins. The encoded protein primarily localizes to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. The encoded protein directly interacts with another large centrosomal protein and is required to anchor microtubules at the centrosome. It is also implicated in the regulation of a class of nuclear hormone receptors in the nucleus. Several alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	C	T	13: 81,419,230	G5275S	probably benign	Het
Akap11	A	G	14: 78,510,259	S1563P	probably damaging	Het
Ankrd50	A	G	3: 38,457,531	V229A	probably damaging	Het
AW112010	A	G	19: 11,050,393		noncoding transcript	Het
Ccdc158	A	G	5: 92,633,328	S873P	probably benign	Het
Chil4	G	A	3: 106,214,362	A57V	probably damaging	Het
Cpa5	A	G	6: 30,624,626	E155G	probably damaging	Het
Ctsq	T	C	13: 61,038,912	I93V	probably benign	Het
Dbi	A	T	1: 120,120,805	I37K	probably benign	Het
Defa35	T	C	8: 21,065,192	S43P	probably damaging	Het
Fance	T	A	17: 28,315,807		probably benign	Het
Fbxl6	A	G	15: 76,537,929	L180P	probably damaging	Het
Fkbpl	T	C	17: 34,646,295	F346L	probably damaging	Het
Gm11735	C	A	11: 116,741,275		noncoding transcript	Het
Gm28042	T	C	2: 120,035,840	I373T	possibly damaging	Het
Golga4	T	C	9: 118,514,186	S27P	probably damaging	Het
Gstm1	C	T	3: 108,016,518		probably null	Het
Lama3	T	A	18: 12,549,253	I1092K	probably benign	Het
Med15	A	T	16: 17,671,564		probably benign	Het
Nlrp6	A	G	7: 140,921,781	D87G	probably damaging	Het
Parp11	A	G	6: 127,471,605	T62A	probably benign	Het
Pcnt	A	G	10: 76,401,483	L1323S	probably damaging	Het
Ppp2r1a	C	T	17: 20,955,810	T98I	probably benign	Het
Pramef6	T	A	4: 143,895,840	Y315F	probably damaging	Het
Prl7a2	T	A	13: 27,660,947	H152L	possibly damaging	Het
Rnf145	T	C	11: 44,564,277	S662P	probably benign	Het
Rpl31-ps17	C	T	12: 54,701,612		noncoding transcript	Het
Tnfaip3	A	T	10: 19,011,627	M50K	probably damaging	Het
Txlnb	T	TTA	10: 17,838,997		probably null	Het
Usp9x	A	G	X: 13,121,448	D638G	possibly damaging	Het
Vmn1r30	A	T	6: 58,435,133	V238E	probably damaging	Het
Zfp507	A	G	7: 35,787,716		probably null	Het
Zfp532	G	T	18: 65,656,565	W1025L	probably benign	Het

Other mutations in Cep350

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Cep350	APN	1	155940746	missense	possibly damaging	0.68
IGL00821:Cep350	APN	1	155862204	missense	probably benign
IGL00837:Cep350	APN	1	155953391	missense	probably damaging	1.00
IGL00977:Cep350	APN	1	155932865	missense	probably null	0.99
IGL01544:Cep350	APN	1	155953187	missense	probably damaging	1.00
IGL01616:Cep350	APN	1	155953247	missense	probably benign	0.00
IGL01695:Cep350	APN	1	155944158	missense	probably damaging	1.00
IGL01902:Cep350	APN	1	155861985	missense	probably damaging	1.00
IGL01977:Cep350	APN	1	155911968	missense	probably benign	0.01
IGL02388:Cep350	APN	1	155953753	missense	probably benign	0.28
IGL02475:Cep350	APN	1	155862595	missense	probably damaging	1.00
IGL02528:Cep350	APN	1	155894615	missense	probably damaging	1.00
IGL02598:Cep350	APN	1	155862967	missense	probably benign	0.00
IGL02676:Cep350	APN	1	155862231	missense	possibly damaging	0.82
IGL02728:Cep350	APN	1	155953222	missense	probably benign	0.02
IGL02744:Cep350	APN	1	155931533	missense	probably damaging	0.98
IGL02817:Cep350	APN	1	155928842	missense	probably damaging	1.00
IGL02892:Cep350	APN	1	155868806	missense	possibly damaging	0.51
IGL03156:Cep350	APN	1	155858042	missense	probably damaging	1.00
IGL03166:Cep350	APN	1	155863600	missense	possibly damaging	0.78
IGL03216:Cep350	APN	1	155860627	missense	probably benign	0.06
IGL03268:Cep350	APN	1	155953549	missense	probably benign	0.16
IGL03358:Cep350	APN	1	155928539	missense	probably benign
primed	UTSW	1	155953588	missense	probably damaging	0.98
stoked	UTSW	1	155915575	missense	probably benign	0.03
NA:Cep350	UTSW	1	155958648	missense	probably damaging	1.00
R0060:Cep350	UTSW	1	155928626	missense	probably damaging	1.00
R0060:Cep350	UTSW	1	155928626	missense	probably damaging	1.00
R0066:Cep350	UTSW	1	155911218	missense	probably damaging	0.99
R0066:Cep350	UTSW	1	155911218	missense	probably damaging	0.99
R0172:Cep350	UTSW	1	155953447	missense	probably benign	0.00
R0365:Cep350	UTSW	1	155906571	missense	probably benign	0.00
R0472:Cep350	UTSW	1	155914723	missense	probably damaging	0.99
R0502:Cep350	UTSW	1	155900883	splice site	probably null
R0538:Cep350	UTSW	1	155848620	missense	possibly damaging	0.80
R0547:Cep350	UTSW	1	155901435	splice site	probably null
R0565:Cep350	UTSW	1	155961195	splice site	probably benign
R0607:Cep350	UTSW	1	155872048	missense	probably damaging	1.00
R0645:Cep350	UTSW	1	155940712	splice site	probably null
R0675:Cep350	UTSW	1	155959753	missense	possibly damaging	0.63
R0828:Cep350	UTSW	1	155953246	missense	probably benign	0.00
R0863:Cep350	UTSW	1	155862235	missense	probably benign	0.00
R0969:Cep350	UTSW	1	155940826	missense	possibly damaging	0.81
R1102:Cep350	UTSW	1	155931518	missense	probably damaging	1.00
R1186:Cep350	UTSW	1	155875376	missense	probably damaging	1.00
R1552:Cep350	UTSW	1	155910738	missense	possibly damaging	0.92
R1560:Cep350	UTSW	1	155929079	missense	possibly damaging	0.48
R1698:Cep350	UTSW	1	155953358	missense	possibly damaging	0.62
R1729:Cep350	UTSW	1	155911981	missense	probably benign	0.17
R1735:Cep350	UTSW	1	155953214	missense	probably damaging	0.99
R1740:Cep350	UTSW	1	155928833	missense	probably damaging	1.00
R1783:Cep350	UTSW	1	155928865	missense	probably damaging	1.00
R1844:Cep350	UTSW	1	155848628	missense	probably damaging	0.99
R1848:Cep350	UTSW	1	155953651	missense	probably benign	0.28
R1988:Cep350	UTSW	1	155933104	missense	possibly damaging	0.82
R2008:Cep350	UTSW	1	155914721	missense	probably benign	0.16
R2241:Cep350	UTSW	1	155958556	splice site	probably null
R2245:Cep350	UTSW	1	155879020	missense	probably benign	0.10
R2402:Cep350	UTSW	1	155863136	missense	probably benign
R2566:Cep350	UTSW	1	155959718	critical splice donor site	probably null
R3160:Cep350	UTSW	1	155863164	missense	probably benign	0.00
R3162:Cep350	UTSW	1	155863164	missense	probably benign	0.00
R3769:Cep350	UTSW	1	155953204	missense	probably damaging	1.00
R4035:Cep350	UTSW	1	155959795	missense	probably benign	0.06
R4158:Cep350	UTSW	1	155932875	missense	probably damaging	1.00
R4160:Cep350	UTSW	1	155932875	missense	probably damaging	1.00
R4213:Cep350	UTSW	1	155935961	missense	probably damaging	1.00
R4648:Cep350	UTSW	1	155902598	missense	possibly damaging	0.85
R4694:Cep350	UTSW	1	155928586	missense	probably damaging	1.00
R4836:Cep350	UTSW	1	155928833	missense	probably damaging	1.00
R4839:Cep350	UTSW	1	155928494	missense	probably benign	0.00
R4969:Cep350	UTSW	1	155860279	missense	probably damaging	0.99
R5014:Cep350	UTSW	1	155928206	missense	probably benign	0.00
R5027:Cep350	UTSW	1	155933354	missense	probably benign	0.01
R5144:Cep350	UTSW	1	155911150	missense	probably damaging	0.99
R5153:Cep350	UTSW	1	155935946	missense	probably damaging	1.00
R5165:Cep350	UTSW	1	155928368	missense	probably damaging	1.00
R5182:Cep350	UTSW	1	155858108	missense	probably damaging	1.00
R5445:Cep350	UTSW	1	155894723	missense	probably benign	0.01
R5738:Cep350	UTSW	1	155866078	missense	probably damaging	1.00
R5809:Cep350	UTSW	1	155933341	missense	probably damaging	0.98
R5855:Cep350	UTSW	1	155953762	missense	probably benign	0.00
R6103:Cep350	UTSW	1	155924576	missense	probably benign	0.05
R6139:Cep350	UTSW	1	155953279	missense	probably benign	0.03
R6285:Cep350	UTSW	1	155953374	missense	possibly damaging	0.48
R6430:Cep350	UTSW	1	155894673	missense	probably damaging	1.00
R6446:Cep350	UTSW	1	155862154	missense	probably benign
R6520:Cep350	UTSW	1	155933336	missense	probably benign	0.02
R6712:Cep350	UTSW	1	155858106	missense	possibly damaging	0.93
R6940:Cep350	UTSW	1	155928551	missense	probably benign	0.01
R7020:Cep350	UTSW	1	155928331	missense	probably damaging	1.00
R7056:Cep350	UTSW	1	155848627	missense	probably damaging	1.00
R7141:Cep350	UTSW	1	155914748	missense	probably damaging	1.00
R7215:Cep350	UTSW	1	155894707	missense	possibly damaging	0.89
R7247:Cep350	UTSW	1	155910753	missense	probably damaging	1.00
R7272:Cep350	UTSW	1	155953588	missense	probably damaging	0.98
R7336:Cep350	UTSW	1	155862276	missense	probably benign	0.17
R7361:Cep350	UTSW	1	155901491	missense	probably damaging	1.00
R7390:Cep350	UTSW	1	155866087	missense	possibly damaging	0.94
R7402:Cep350	UTSW	1	155928215	missense	probably benign	0.00
R7428:Cep350	UTSW	1	155894619	missense	probably benign	0.00
R7440:Cep350	UTSW	1	155940772	missense	probably damaging	0.98
R7520:Cep350	UTSW	1	155915629	missense	probably benign	0.05
R7529:Cep350	UTSW	1	155861923	missense	probably benign	0.08
R7635:Cep350	UTSW	1	155879021	nonsense	probably null
R7806:Cep350	UTSW	1	155862063	missense	probably benign	0.00
R8100:Cep350	UTSW	1	155953402	missense	probably damaging	0.97
R8192:Cep350	UTSW	1	155940783	missense	possibly damaging	0.94
R8193:Cep350	UTSW	1	155862079	missense	probably benign	0.01
R8351:Cep350	UTSW	1	155872034	missense	probably damaging	0.99
R8406:Cep350	UTSW	1	155922418	missense	probably benign	0.00
R8451:Cep350	UTSW	1	155872034	missense	probably damaging	0.99
R8467:Cep350	UTSW	1	155915575	missense	probably benign	0.03
R8543:Cep350	UTSW	1	155862376	missense	probably damaging	0.98
R8714:Cep350	UTSW	1	155860731	missense	probably damaging	0.98
R8810:Cep350	UTSW	1	155928116	missense	probably damaging	1.00
R8837:Cep350	UTSW	1	155861772	missense	probably benign	0.09
R8933:Cep350	UTSW	1	155863415	missense	probably benign	0.01
R9043:Cep350	UTSW	1	155897482	missense	probably damaging	1.00
R9050:Cep350	UTSW	1	155862941	missense	possibly damaging	0.81
R9067:Cep350	UTSW	1	155861739	missense	probably benign	0.00
R9105:Cep350	UTSW	1	155959815	missense	probably damaging	1.00
R9295:Cep350	UTSW	1	155862305	nonsense	probably null
R9304:Cep350	UTSW	1	155953718	missense	probably damaging	0.98
R9456:Cep350	UTSW	1	155868711	missense	probably benign	0.00
R9575:Cep350	UTSW	1	155875367	missense	probably benign	0.03
R9715:Cep350	UTSW	1	155875361	missense	probably benign	0.00
R9749:Cep350	UTSW	1	155953239	missense	probably benign	0.02
R9758:Cep350	UTSW	1	155894687	missense	probably damaging	0.96
R9767:Cep350	UTSW	1	155863272	missense	probably benign	0.01
RF020:Cep350	UTSW	1	155915478	missense	probably benign	0.34
X0018:Cep350	UTSW	1	155953286	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- ACTATCAAGTCAGCTCAGGC -3'
(R):5'- AAGCAAATGAAAGAATCCCTTGT -3'

Sequencing Primer
(F):5'- TATCAAGTCAGCTCAGGCAGTCTG -3'
(R):5'- GCAAATGAAAGAATCCCTTGTTTATG -3'

Posted On

2015-07-21