Mutagenetix > Incidental Mutation

Incidental Mutation 'R4483:Gm28042'

331487

Institutional Source

Beutler Lab

Gene Symbol

Gm28042

Ensembl Gene

ENSMUSG00000033852

Gene Name

predicted gene, 28042

Synonyms

MMRRC Submission

041739-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.497) question?

Stock #

R4483 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120027493-120043033 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 120035840 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 373 (I373T)

Ref Sequence

ENSEMBL: ENSMUSP00000117535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044675] [ENSMUST00000126150] [ENSMUST00000129685] [ENSMUST00000156805] [ENSMUST00000162393]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000044675

SMART Domains

Protein: ENSMUSP00000041220
Gene: ENSMUSG00000098789

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
JmjC	128	307	4.31e-39	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125805

SMART Domains

Protein: ENSMUSP00000122869
Gene: ENSMUSG00000033852

Domain	Start	End	E-Value	Type
Pfam:Cupin_8	2	62	2.8e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000126150
AA Change: I150T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000118458
Gene: ENSMUSG00000098488
AA Change: I150T

Domain	Start	End	E-Value	Type
C2	19	119	1.79e-17	SMART
PLAc	233	789	1.99e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000129685
AA Change: I373T

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000115498
Gene: ENSMUSG00000033852
AA Change: I373T

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
JmjC	128	308	1.65e-4	SMART
C2	242	342	1.79e-17	SMART
PLAc	456	1012	1.99e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130176

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134380

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136042

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139862

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143794

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153571

Predicted Effect

possibly damaging
Transcript: ENSMUST00000156805
AA Change: I373T

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000117535
Gene: ENSMUSG00000033852
AA Change: I373T

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
JmjC	128	308	1.65e-4	SMART
C2	242	342	1.79e-17	SMART
PLAc	456	892	8.56e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162393

SMART Domains

Protein: ENSMUSP00000125329
Gene: ENSMUSG00000033852

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
JmjC	128	242	4.42e-3	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: This locus represents naturally-occurring readthrough transcription between the neighboring Jmjd7 (jumonji domain containing 7) and Pla2g4b (phospholipase A2, group IVB (cytosolic)) genes on chromosome 2. The readthrough transcript is a candidate for nonsense-mediated mRNA decay (NMD), and is unlikely to produce a protein product. [provided by RefSeq, Oct 2013]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	C	T	13: 81,419,230	G5275S	probably benign	Het
Akap11	A	G	14: 78,510,259	S1563P	probably damaging	Het
Ankrd50	A	G	3: 38,457,531	V229A	probably damaging	Het
AW112010	A	G	19: 11,050,393		noncoding transcript	Het
Ccdc158	A	G	5: 92,633,328	S873P	probably benign	Het
Cep350	A	G	1: 155,926,468	V1104A	probably benign	Het
Chil4	G	A	3: 106,214,362	A57V	probably damaging	Het
Cpa5	A	G	6: 30,624,626	E155G	probably damaging	Het
Ctsq	T	C	13: 61,038,912	I93V	probably benign	Het
Dbi	A	T	1: 120,120,805	I37K	probably benign	Het
Defa35	T	C	8: 21,065,192	S43P	probably damaging	Het
Fance	T	A	17: 28,315,807		probably benign	Het
Fbxl6	A	G	15: 76,537,929	L180P	probably damaging	Het
Fkbpl	T	C	17: 34,646,295	F346L	probably damaging	Het
Gm11735	C	A	11: 116,741,275		noncoding transcript	Het
Golga4	T	C	9: 118,514,186	S27P	probably damaging	Het
Gstm1	C	T	3: 108,016,518		probably null	Het
Lama3	T	A	18: 12,549,253	I1092K	probably benign	Het
Med15	A	T	16: 17,671,564		probably benign	Het
Nlrp6	A	G	7: 140,921,781	D87G	probably damaging	Het
Parp11	A	G	6: 127,471,605	T62A	probably benign	Het
Pcnt	A	G	10: 76,401,483	L1323S	probably damaging	Het
Ppp2r1a	C	T	17: 20,955,810	T98I	probably benign	Het
Pramef6	T	A	4: 143,895,840	Y315F	probably damaging	Het
Prl7a2	T	A	13: 27,660,947	H152L	possibly damaging	Het
Rnf145	T	C	11: 44,564,277	S662P	probably benign	Het
Rpl31-ps17	C	T	12: 54,701,612		noncoding transcript	Het
Tnfaip3	A	T	10: 19,011,627	M50K	probably damaging	Het
Txlnb	T	TTA	10: 17,838,997		probably null	Het
Usp9x	A	G	X: 13,121,448	D638G	possibly damaging	Het
Vmn1r30	A	T	6: 58,435,133	V238E	probably damaging	Het
Zfp507	A	G	7: 35,787,716		probably null	Het
Zfp532	G	T	18: 65,656,565	W1025L	probably benign	Het

Other mutations in Gm28042

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Gm28042	APN	2	120030356	missense	probably damaging	1.00
IGL01148:Gm28042	APN	2	120039038	missense	possibly damaging	0.74
IGL02005:Gm28042	APN	2	120034634	missense	possibly damaging	0.95
IGL02237:Gm28042	APN	2	120039899	missense	possibly damaging	0.61
IGL02539:Gm28042	APN	2	120035221	missense	probably damaging	1.00
IGL02747:Gm28042	APN	2	120031394	missense	probably damaging	1.00
IGL02825:Gm28042	APN	2	120031644	missense	probably damaging	0.99
IGL02998:Gm28042	APN	2	120040154	missense	possibly damaging	0.70
IGL03057:Gm28042	APN	2	120032156	missense	probably damaging	1.00
IGL03084:Gm28042	APN	2	120040505	missense	probably benign	0.08
IGL03160:Gm28042	APN	2	120035828	missense	possibly damaging	0.94
PIT4520001:Gm28042	UTSW	2	120039667	nonsense	probably null
R0147:Gm28042	UTSW	2	120036463	missense	probably benign	0.00
R0270:Gm28042	UTSW	2	120041592	missense	probably benign	0.06
R0315:Gm28042	UTSW	2	120039057	missense	probably damaging	1.00
R1421:Gm28042	UTSW	2	120036463	missense	probably benign	0.00
R1589:Gm28042	UTSW	2	120041406	missense	probably benign	0.05
R1599:Gm28042	UTSW	2	120036463	missense	probably benign	0.00
R1656:Gm28042	UTSW	2	120038889	missense	probably damaging	1.00
R1718:Gm28042	UTSW	2	120036391	missense	possibly damaging	0.78
R1969:Gm28042	UTSW	2	120041615	makesense	probably null
R2164:Gm28042	UTSW	2	120036748	missense	probably benign	0.01
R2275:Gm28042	UTSW	2	120036829	missense	probably damaging	1.00
R3976:Gm28042	UTSW	2	120036756	missense	probably benign	0.11
R4614:Gm28042	UTSW	2	120041158	missense	probably damaging	0.99
R4802:Gm28042	UTSW	2	120042054	utr 3 prime	probably benign
R4976:Gm28042	UTSW	2	120034643	missense	probably damaging	1.00
R5119:Gm28042	UTSW	2	120034643	missense	probably damaging	1.00
R5177:Gm28042	UTSW	2	120041601	splice site	probably null
R5340:Gm28042	UTSW	2	120041448	missense	probably benign
R5861:Gm28042	UTSW	2	120034635	missense	probably damaging	1.00
R6641:Gm28042	UTSW	2	120039683	missense	probably damaging	1.00
R7187:Gm28042	UTSW	2	120039695	missense	probably damaging	1.00
R7488:Gm28042	UTSW	2	120039957	missense	probably benign	0.00
R7699:Gm28042	UTSW	2	120039716	missense	possibly damaging	0.81
R7700:Gm28042	UTSW	2	120039716	missense	possibly damaging	0.81
R8432:Gm28042	UTSW	2	120038596	missense	probably damaging	1.00
R9120:Gm28042	UTSW	2	120038981	missense	probably damaging	0.96
R9265:Gm28042	UTSW	2	120041224	missense	probably damaging	1.00
R9803:Gm28042	UTSW	2	120038503	missense	possibly damaging	0.88
X0019:Gm28042	UTSW	2	120039658	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCGGCTACAGACTCTGTAAGTTG -3'
(R):5'- CCTGAGTCACTAAGCATTGACTTG -3'

Sequencing Primer
(F):5'- CTACAGACTCTGTAAGTTGGTCTTG -3'
(R):5'- GAGATGTACTCTCTTGGGAACATGC -3'

Posted On

2015-07-21