Mutagenetix > Incidental Mutation

Incidental Mutation 'R4483:Cpa5'

331492

Institutional Source

Beutler Lab

Gene Symbol

Cpa5

Ensembl Gene

ENSMUSG00000029788

Gene Name

carboxypeptidase A5

Synonyms

MMRRC Submission

041739-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R4483 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30611010-30631745 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30624626 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 155 (E155G)

Ref Sequence

ENSEMBL: ENSMUSP00000126436 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062758] [ENSMUST00000115138] [ENSMUST00000115139] [ENSMUST00000165949]

AlphaFold

Q8R4H4

Predicted Effect

probably damaging
Transcript: ENSMUST00000062758
AA Change: E155G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000057722
Gene: ENSMUSG00000029788
AA Change: E155G

Domain	Start	End	E-Value	Type
Pfam:Propep_M14	43	117	5.6e-23	PFAM
Zn_pept	139	419	4.83e-125	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115138
AA Change: E155G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110791
Gene: ENSMUSG00000029788
AA Change: E155G

Domain	Start	End	E-Value	Type
Pfam:Propep_M14	43	118	9.9e-26	PFAM
Zn_pept	139	395	4.62e-81	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115139
AA Change: E155G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110792
Gene: ENSMUSG00000029788
AA Change: E155G

Domain	Start	End	E-Value	Type
Pfam:Propep_M14	43	118	4.6e-25	PFAM
Zn_pept	139	419	4.83e-125	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000165949
AA Change: E155G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126436
Gene: ENSMUSG00000029788
AA Change: E155G

Domain	Start	End	E-Value	Type
Pfam:Propep_M14	43	118	6.4e-26	PFAM
Zn_pept	139	309	3.6e-19	SMART

Meta Mutation Damage Score

0.2771

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: This gene encodes a member of the carboxypeptidase A family of zinc metalloproteases. The encoded preproprotein undergoes proteolytic processing that removes the N-terminal activation peptide to generate a functional enzyme. This gene is expressed in mouse testes where the encoded protein is localized to the germ cells. This gene is located in a cluster of carboxypeptidase genes on chromosome 6. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	C	T	13: 81,419,230	G5275S	probably benign	Het
Akap11	A	G	14: 78,510,259	S1563P	probably damaging	Het
Ankrd50	A	G	3: 38,457,531	V229A	probably damaging	Het
AW112010	A	G	19: 11,050,393		noncoding transcript	Het
Ccdc158	A	G	5: 92,633,328	S873P	probably benign	Het
Cep350	A	G	1: 155,926,468	V1104A	probably benign	Het
Chil4	G	A	3: 106,214,362	A57V	probably damaging	Het
Ctsq	T	C	13: 61,038,912	I93V	probably benign	Het
Dbi	A	T	1: 120,120,805	I37K	probably benign	Het
Defa35	T	C	8: 21,065,192	S43P	probably damaging	Het
Fance	T	A	17: 28,315,807		probably benign	Het
Fbxl6	A	G	15: 76,537,929	L180P	probably damaging	Het
Fkbpl	T	C	17: 34,646,295	F346L	probably damaging	Het
Gm11735	C	A	11: 116,741,275		noncoding transcript	Het
Gm28042	T	C	2: 120,035,840	I373T	possibly damaging	Het
Golga4	T	C	9: 118,514,186	S27P	probably damaging	Het
Gstm1	C	T	3: 108,016,518		probably null	Het
Lama3	T	A	18: 12,549,253	I1092K	probably benign	Het
Med15	A	T	16: 17,671,564		probably benign	Het
Nlrp6	A	G	7: 140,921,781	D87G	probably damaging	Het
Parp11	A	G	6: 127,471,605	T62A	probably benign	Het
Pcnt	A	G	10: 76,401,483	L1323S	probably damaging	Het
Ppp2r1a	C	T	17: 20,955,810	T98I	probably benign	Het
Pramef6	T	A	4: 143,895,840	Y315F	probably damaging	Het
Prl7a2	T	A	13: 27,660,947	H152L	possibly damaging	Het
Rnf145	T	C	11: 44,564,277	S662P	probably benign	Het
Rpl31-ps17	C	T	12: 54,701,612		noncoding transcript	Het
Tnfaip3	A	T	10: 19,011,627	M50K	probably damaging	Het
Txlnb	T	TTA	10: 17,838,997		probably null	Het
Usp9x	A	G	X: 13,121,448	D638G	possibly damaging	Het
Vmn1r30	A	T	6: 58,435,133	V238E	probably damaging	Het
Zfp507	A	G	7: 35,787,716		probably null	Het
Zfp532	G	T	18: 65,656,565	W1025L	probably benign	Het

Other mutations in Cpa5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01757:Cpa5	APN	6	30625927	splice site	probably benign
IGL02577:Cpa5	APN	6	30626808	splice site	probably benign
IGL03148:Cpa5	APN	6	30630437	missense	probably damaging	1.00
IGL03341:Cpa5	APN	6	30626291	missense	possibly damaging	0.57
R0836:Cpa5	UTSW	6	30623211	missense	probably damaging	1.00
R1437:Cpa5	UTSW	6	30624655	missense	probably damaging	1.00
R2146:Cpa5	UTSW	6	30626822	missense	probably damaging	1.00
R2285:Cpa5	UTSW	6	30615064	missense	probably benign	0.09
R2334:Cpa5	UTSW	6	30624606	nonsense	probably null
R4081:Cpa5	UTSW	6	30631229	missense	probably benign	0.02
R4454:Cpa5	UTSW	6	30626324	missense	possibly damaging	0.84
R4758:Cpa5	UTSW	6	30615160	missense	possibly damaging	0.67
R4771:Cpa5	UTSW	6	30612685	nonsense	probably null
R4953:Cpa5	UTSW	6	30631364	missense	possibly damaging	0.84
R5053:Cpa5	UTSW	6	30623272	missense	probably damaging	1.00
R5392:Cpa5	UTSW	6	30630830	nonsense	probably null
R5593:Cpa5	UTSW	6	30630849	missense	probably benign	0.10
R5745:Cpa5	UTSW	6	30630437	missense	probably damaging	1.00
R5900:Cpa5	UTSW	6	30615116	missense	probably damaging	1.00
R6264:Cpa5	UTSW	6	30613985	missense	probably damaging	1.00
R6268:Cpa5	UTSW	6	30615173	missense	probably damaging	1.00
R6376:Cpa5	UTSW	6	30614045	missense	probably benign
R6634:Cpa5	UTSW	6	30626364	missense	probably damaging	1.00
R6814:Cpa5	UTSW	6	30614054	missense	probably benign	0.03
R6872:Cpa5	UTSW	6	30614054	missense	probably benign	0.03
R6989:Cpa5	UTSW	6	30625892	missense	probably benign	0.06
R7205:Cpa5	UTSW	6	30630830	missense	probably benign
R7499:Cpa5	UTSW	6	30630857	missense	possibly damaging	0.81
R7864:Cpa5	UTSW	6	30631395	missense	probably damaging	0.97
R8170:Cpa5	UTSW	6	30624595	missense	probably benign	0.35
R9027:Cpa5	UTSW	6	30612605	start codon destroyed	probably null	0.88
R9395:Cpa5	UTSW	6	30631281	missense	probably damaging	1.00
R9607:Cpa5	UTSW	6	30626339	missense	probably damaging	1.00
R9687:Cpa5	UTSW	6	30614042	missense	probably benign
R9794:Cpa5	UTSW	6	30625921	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACAGCTCGATGTCCTTTAGC -3'
(R):5'- ACTTCCCTAGCCAGACACTG -3'

Sequencing Primer
(F):5'- AGCTCGATGTCCTTTAGCTCTGAG -3'
(R):5'- TAGCCAGACACTGCTGCC -3'

Posted On

2015-07-21