Incidental Mutation 'R4483:Cpa5'
ID 331492
Institutional Source Beutler Lab
Gene Symbol Cpa5
Ensembl Gene ENSMUSG00000029788
Gene Name carboxypeptidase A5
Synonyms 4930430M09Rik
MMRRC Submission 041739-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R4483 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 30611009-30631744 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30624625 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 155 (E155G)
Ref Sequence ENSEMBL: ENSMUSP00000126436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062758] [ENSMUST00000115138] [ENSMUST00000115139] [ENSMUST00000165949]
AlphaFold Q8R4H4
Predicted Effect probably damaging
Transcript: ENSMUST00000062758
AA Change: E155G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057722
Gene: ENSMUSG00000029788
AA Change: E155G

DomainStartEndE-ValueType
Pfam:Propep_M14 43 117 5.6e-23 PFAM
Zn_pept 139 419 4.83e-125 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115138
AA Change: E155G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110791
Gene: ENSMUSG00000029788
AA Change: E155G

DomainStartEndE-ValueType
Pfam:Propep_M14 43 118 9.9e-26 PFAM
Zn_pept 139 395 4.62e-81 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115139
AA Change: E155G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110792
Gene: ENSMUSG00000029788
AA Change: E155G

DomainStartEndE-ValueType
Pfam:Propep_M14 43 118 4.6e-25 PFAM
Zn_pept 139 419 4.83e-125 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165949
AA Change: E155G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126436
Gene: ENSMUSG00000029788
AA Change: E155G

DomainStartEndE-ValueType
Pfam:Propep_M14 43 118 6.4e-26 PFAM
Zn_pept 139 309 3.6e-19 SMART
Meta Mutation Damage Score 0.2771 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: This gene encodes a member of the carboxypeptidase A family of zinc metalloproteases. The encoded preproprotein undergoes proteolytic processing that removes the N-terminal activation peptide to generate a functional enzyme. This gene is expressed in mouse testes where the encoded protein is localized to the germ cells. This gene is located in a cluster of carboxypeptidase genes on chromosome 6. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,567,349 (GRCm39) G5275S probably benign Het
Akap11 A G 14: 78,747,699 (GRCm39) S1563P probably damaging Het
Ankrd50 A G 3: 38,511,680 (GRCm39) V229A probably damaging Het
AW112010 A G 19: 11,027,757 (GRCm39) noncoding transcript Het
Ccdc158 A G 5: 92,781,187 (GRCm39) S873P probably benign Het
Cep350 A G 1: 155,802,214 (GRCm39) V1104A probably benign Het
Chil4 G A 3: 106,121,678 (GRCm39) A57V probably damaging Het
Ctsq T C 13: 61,186,726 (GRCm39) I93V probably benign Het
Dbi A T 1: 120,048,535 (GRCm39) I37K probably benign Het
Defa35 T C 8: 21,555,208 (GRCm39) S43P probably damaging Het
Fance T A 17: 28,534,781 (GRCm39) probably benign Het
Fbxl6 A G 15: 76,422,129 (GRCm39) L180P probably damaging Het
Fkbpl T C 17: 34,865,269 (GRCm39) F346L probably damaging Het
Gm11735 C A 11: 116,632,101 (GRCm39) noncoding transcript Het
Gm28042 T C 2: 119,866,321 (GRCm39) I373T possibly damaging Het
Golga4 T C 9: 118,343,254 (GRCm39) S27P probably damaging Het
Gstm1 C T 3: 107,923,834 (GRCm39) probably null Het
Lama3 T A 18: 12,682,310 (GRCm39) I1092K probably benign Het
Med15 A T 16: 17,489,428 (GRCm39) probably benign Het
Nlrp6 A G 7: 140,501,694 (GRCm39) D87G probably damaging Het
Parp11 A G 6: 127,448,568 (GRCm39) T62A probably benign Het
Pcnt A G 10: 76,237,317 (GRCm39) L1323S probably damaging Het
Ppp2r1a C T 17: 21,176,072 (GRCm39) T98I probably benign Het
Pramel11 T A 4: 143,622,410 (GRCm39) Y315F probably damaging Het
Prl7a2 T A 13: 27,844,930 (GRCm39) H152L possibly damaging Het
Rnf145 T C 11: 44,455,104 (GRCm39) S662P probably benign Het
Rpl31-ps17 C T 12: 54,748,397 (GRCm39) noncoding transcript Het
Tnfaip3 A T 10: 18,887,375 (GRCm39) M50K probably damaging Het
Txlnb T TTA 10: 17,714,745 (GRCm39) probably null Het
Usp9x A G X: 12,987,687 (GRCm39) D638G possibly damaging Het
Vmn1r30 A T 6: 58,412,118 (GRCm39) V238E probably damaging Het
Zfp507 A G 7: 35,487,141 (GRCm39) probably null Het
Zfp532 G T 18: 65,789,636 (GRCm39) W1025L probably benign Het
Other mutations in Cpa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01757:Cpa5 APN 6 30,625,926 (GRCm39) splice site probably benign
IGL02577:Cpa5 APN 6 30,626,807 (GRCm39) splice site probably benign
IGL03148:Cpa5 APN 6 30,630,436 (GRCm39) missense probably damaging 1.00
IGL03341:Cpa5 APN 6 30,626,290 (GRCm39) missense possibly damaging 0.57
R0836:Cpa5 UTSW 6 30,623,210 (GRCm39) missense probably damaging 1.00
R1437:Cpa5 UTSW 6 30,624,654 (GRCm39) missense probably damaging 1.00
R2146:Cpa5 UTSW 6 30,626,821 (GRCm39) missense probably damaging 1.00
R2285:Cpa5 UTSW 6 30,615,063 (GRCm39) missense probably benign 0.09
R2334:Cpa5 UTSW 6 30,624,605 (GRCm39) nonsense probably null
R4081:Cpa5 UTSW 6 30,631,228 (GRCm39) missense probably benign 0.02
R4454:Cpa5 UTSW 6 30,626,323 (GRCm39) missense possibly damaging 0.84
R4758:Cpa5 UTSW 6 30,615,159 (GRCm39) missense possibly damaging 0.67
R4771:Cpa5 UTSW 6 30,612,684 (GRCm39) nonsense probably null
R4953:Cpa5 UTSW 6 30,631,363 (GRCm39) missense possibly damaging 0.84
R5053:Cpa5 UTSW 6 30,623,271 (GRCm39) missense probably damaging 1.00
R5392:Cpa5 UTSW 6 30,630,829 (GRCm39) nonsense probably null
R5593:Cpa5 UTSW 6 30,630,848 (GRCm39) missense probably benign 0.10
R5745:Cpa5 UTSW 6 30,630,436 (GRCm39) missense probably damaging 1.00
R5900:Cpa5 UTSW 6 30,615,115 (GRCm39) missense probably damaging 1.00
R6264:Cpa5 UTSW 6 30,613,984 (GRCm39) missense probably damaging 1.00
R6268:Cpa5 UTSW 6 30,615,172 (GRCm39) missense probably damaging 1.00
R6376:Cpa5 UTSW 6 30,614,044 (GRCm39) missense probably benign
R6634:Cpa5 UTSW 6 30,626,363 (GRCm39) missense probably damaging 1.00
R6814:Cpa5 UTSW 6 30,614,053 (GRCm39) missense probably benign 0.03
R6872:Cpa5 UTSW 6 30,614,053 (GRCm39) missense probably benign 0.03
R6989:Cpa5 UTSW 6 30,625,891 (GRCm39) missense probably benign 0.06
R7205:Cpa5 UTSW 6 30,630,829 (GRCm39) missense probably benign
R7499:Cpa5 UTSW 6 30,630,856 (GRCm39) missense possibly damaging 0.81
R7864:Cpa5 UTSW 6 30,631,394 (GRCm39) missense probably damaging 0.97
R8170:Cpa5 UTSW 6 30,624,594 (GRCm39) missense probably benign 0.35
R9027:Cpa5 UTSW 6 30,612,604 (GRCm39) start codon destroyed probably null 0.88
R9395:Cpa5 UTSW 6 30,631,280 (GRCm39) missense probably damaging 1.00
R9607:Cpa5 UTSW 6 30,626,338 (GRCm39) missense probably damaging 1.00
R9687:Cpa5 UTSW 6 30,614,041 (GRCm39) missense probably benign
R9794:Cpa5 UTSW 6 30,625,920 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACAGCTCGATGTCCTTTAGC -3'
(R):5'- ACTTCCCTAGCCAGACACTG -3'

Sequencing Primer
(F):5'- AGCTCGATGTCCTTTAGCTCTGAG -3'
(R):5'- TAGCCAGACACTGCTGCC -3'
Posted On 2015-07-21