Incidental Mutation 'R4483:Zfp507'
ID 331495
Institutional Source Beutler Lab
Gene Symbol Zfp507
Ensembl Gene ENSMUSG00000044452
Gene Name zinc finger protein 507
Synonyms 1810022O10Rik, A230056M16Rik
MMRRC Submission 041739-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.339) question?
Stock # R4483 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 35772343-35803003 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 35787716 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061586] [ENSMUST00000187282] [ENSMUST00000205670] [ENSMUST00000206615]
AlphaFold Q6ZPY5
Predicted Effect probably null
Transcript: ENSMUST00000061586
SMART Domains Protein: ENSMUSP00000058609
Gene: ENSMUSG00000044452

DomainStartEndE-ValueType
ZnF_C2H2 122 144 1.56e-2 SMART
ZnF_C2H2 152 175 2.49e-1 SMART
low complexity region 178 192 N/A INTRINSIC
ZnF_C2H2 237 259 8.52e0 SMART
ZnF_C2H2 630 652 2.75e-3 SMART
ZnF_C2H2 658 680 1.26e-2 SMART
ZnF_C2H2 686 709 5.42e-2 SMART
ZnF_C2H2 746 768 4.79e-3 SMART
ZnF_C2H2 774 796 1.45e-2 SMART
ZnF_C2H2 899 921 3.83e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000187282
SMART Domains Protein: ENSMUSP00000140940
Gene: ENSMUSG00000044452

DomainStartEndE-ValueType
ZnF_C2H2 107 129 1.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205670
Predicted Effect probably null
Transcript: ENSMUST00000206615
Meta Mutation Damage Score 0.9493 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,419,230 G5275S probably benign Het
Akap11 A G 14: 78,510,259 S1563P probably damaging Het
Ankrd50 A G 3: 38,457,531 V229A probably damaging Het
AW112010 A G 19: 11,050,393 noncoding transcript Het
Ccdc158 A G 5: 92,633,328 S873P probably benign Het
Cep350 A G 1: 155,926,468 V1104A probably benign Het
Chil4 G A 3: 106,214,362 A57V probably damaging Het
Cpa5 A G 6: 30,624,626 E155G probably damaging Het
Ctsq T C 13: 61,038,912 I93V probably benign Het
Dbi A T 1: 120,120,805 I37K probably benign Het
Defa35 T C 8: 21,065,192 S43P probably damaging Het
Fance T A 17: 28,315,807 probably benign Het
Fbxl6 A G 15: 76,537,929 L180P probably damaging Het
Fkbpl T C 17: 34,646,295 F346L probably damaging Het
Gm11735 C A 11: 116,741,275 noncoding transcript Het
Gm28042 T C 2: 120,035,840 I373T possibly damaging Het
Golga4 T C 9: 118,514,186 S27P probably damaging Het
Gstm1 C T 3: 108,016,518 probably null Het
Lama3 T A 18: 12,549,253 I1092K probably benign Het
Med15 A T 16: 17,671,564 probably benign Het
Nlrp6 A G 7: 140,921,781 D87G probably damaging Het
Parp11 A G 6: 127,471,605 T62A probably benign Het
Pcnt A G 10: 76,401,483 L1323S probably damaging Het
Ppp2r1a C T 17: 20,955,810 T98I probably benign Het
Pramef6 T A 4: 143,895,840 Y315F probably damaging Het
Prl7a2 T A 13: 27,660,947 H152L possibly damaging Het
Rnf145 T C 11: 44,564,277 S662P probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Tnfaip3 A T 10: 19,011,627 M50K probably damaging Het
Txlnb T TTA 10: 17,838,997 probably null Het
Usp9x A G X: 13,121,448 D638G possibly damaging Het
Vmn1r30 A T 6: 58,435,133 V238E probably damaging Het
Zfp532 G T 18: 65,656,565 W1025L probably benign Het
Other mutations in Zfp507
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Zfp507 APN 7 35794712 missense possibly damaging 0.93
IGL00835:Zfp507 APN 7 35776038 missense probably damaging 1.00
IGL01083:Zfp507 APN 7 35794038 missense probably benign 0.00
IGL01359:Zfp507 APN 7 35794502 missense probably damaging 1.00
IGL01418:Zfp507 APN 7 35793812 splice site probably null
IGL02122:Zfp507 APN 7 35776095 missense probably damaging 1.00
IGL02506:Zfp507 APN 7 35776466 missense probably damaging 1.00
IGL02601:Zfp507 APN 7 35791711 missense probably damaging 1.00
IGL02643:Zfp507 APN 7 35795231 missense probably damaging 0.99
IGL03129:Zfp507 APN 7 35794206 missense probably damaging 1.00
R0400:Zfp507 UTSW 7 35791746 missense probably damaging 1.00
R0812:Zfp507 UTSW 7 35802623 intron probably benign
R1183:Zfp507 UTSW 7 35794890 missense probably damaging 0.99
R1381:Zfp507 UTSW 7 35776010 missense possibly damaging 0.91
R1542:Zfp507 UTSW 7 35794801 missense possibly damaging 0.71
R1626:Zfp507 UTSW 7 35795433 missense probably damaging 1.00
R1759:Zfp507 UTSW 7 35775978 missense probably damaging 0.99
R1843:Zfp507 UTSW 7 35793725 missense probably damaging 0.97
R1852:Zfp507 UTSW 7 35787751 missense probably damaging 1.00
R1893:Zfp507 UTSW 7 35802627 intron probably benign
R1923:Zfp507 UTSW 7 35793725 missense probably damaging 0.97
R1925:Zfp507 UTSW 7 35793725 missense probably damaging 0.97
R1927:Zfp507 UTSW 7 35793725 missense probably damaging 0.97
R2139:Zfp507 UTSW 7 35793723 missense probably damaging 1.00
R2191:Zfp507 UTSW 7 35794843 missense probably damaging 1.00
R2431:Zfp507 UTSW 7 35795402 missense probably benign 0.08
R2921:Zfp507 UTSW 7 35794799 missense probably damaging 1.00
R2922:Zfp507 UTSW 7 35794799 missense probably damaging 1.00
R3436:Zfp507 UTSW 7 35787770 missense probably damaging 1.00
R4751:Zfp507 UTSW 7 35794382 missense probably damaging 0.99
R4852:Zfp507 UTSW 7 35794055 missense probably benign 0.01
R5298:Zfp507 UTSW 7 35775996 missense probably damaging 0.99
R5602:Zfp507 UTSW 7 35776238 nonsense probably null
R5707:Zfp507 UTSW 7 35794163 missense probably damaging 1.00
R5785:Zfp507 UTSW 7 35787742 missense probably benign 0.20
R6140:Zfp507 UTSW 7 35794188 missense probably damaging 1.00
R6674:Zfp507 UTSW 7 35794734 missense probably damaging 0.98
R6714:Zfp507 UTSW 7 35787727 missense probably damaging 0.99
R7045:Zfp507 UTSW 7 35795553 missense possibly damaging 0.56
R7334:Zfp507 UTSW 7 35776080 missense probably damaging 1.00
R7365:Zfp507 UTSW 7 35776418 missense unknown
R7569:Zfp507 UTSW 7 35794544 missense probably damaging 0.99
R7662:Zfp507 UTSW 7 35787804 nonsense probably null
R7846:Zfp507 UTSW 7 35794538 missense probably damaging 1.00
R9100:Zfp507 UTSW 7 35795021 missense probably benign 0.39
R9136:Zfp507 UTSW 7 35776458 missense probably damaging 0.96
R9513:Zfp507 UTSW 7 35776148 missense probably benign 0.00
Z1088:Zfp507 UTSW 7 35794277 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGCTGAACTGAGACTCACGC -3'
(R):5'- CCTTGGCACGTAGTATCATAATTAC -3'

Sequencing Primer
(F):5'- GCTGAACTGAGACTCACGCTTAATG -3'
(R):5'- CATGATGAGGTGTAAATGCTCCC -3'
Posted On 2015-07-21