Mutagenetix > Incidental Mutation

Incidental Mutation 'R4483:Tnfaip3'

331499

Institutional Source

Beutler Lab

Gene Symbol

Tnfaip3

Ensembl Gene

ENSMUSG00000019850

Gene Name

tumor necrosis factor, alpha-induced protein 3

Synonyms

A20, zinc finger protein A20, Tnfip3

MMRRC Submission

041739-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4483 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19000910-19015657 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 19011627 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 50 (M50K)

Ref Sequence

ENSEMBL: ENSMUSP00000120627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019997] [ENSMUST00000105527] [ENSMUST00000122863] [ENSMUST00000146388]

AlphaFold

Q60769

Predicted Effect

probably damaging
Transcript: ENSMUST00000019997
AA Change: M50K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000019997
Gene: ENSMUSG00000019850
AA Change: M50K

Domain	Start	End	E-Value	Type
Pfam:OTU	98	257	1.2e-30	PFAM
ZnF_A20	384	409	8.06e-9	SMART
low complexity region	425	436	N/A	INTRINSIC
ZnF_A20	467	492	3.76e-9	SMART
ZnF_A20	503	526	4.74e-6	SMART
low complexity region	528	543	N/A	INTRINSIC
ZnF_A20	589	614	6.01e-8	SMART
ZnF_A20	639	664	1.56e-6	SMART
ZnF_A20	698	723	1.68e-6	SMART
ZnF_A20	744	769	2.81e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105527
AA Change: M50K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101167
Gene: ENSMUSG00000019850
AA Change: M50K

Domain	Start	End	E-Value	Type
Pfam:OTU	98	257	7.8e-34	PFAM
ZnF_A20	384	409	8.06e-9	SMART
low complexity region	425	436	N/A	INTRINSIC
ZnF_A20	467	492	3.76e-9	SMART
ZnF_A20	503	526	4.74e-6	SMART
low complexity region	528	543	N/A	INTRINSIC
ZnF_A20	589	614	6.01e-8	SMART
ZnF_A20	639	664	1.56e-6	SMART
ZnF_A20	698	723	1.68e-6	SMART
ZnF_A20	744	769	2.81e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000122863
AA Change: M50K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000116318
Gene: ENSMUSG00000019850
AA Change: M50K

Domain	Start	End	E-Value	Type
PDB:2VFJ\|D	1	122	2e-83	PDB
SCOP:d1e3ha3	18	109	2e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000146388
AA Change: M50K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000120627
Gene: ENSMUSG00000019850
AA Change: M50K

Domain	Start	End	E-Value	Type
PDB:3ZJG\|B	1	87	1e-56	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154590

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154749

Meta Mutation Damage Score

0.9127

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis factor (TNF). The protein encoded by this gene is a zinc finger protein and ubiqitin-editing enzyme, and has been shown to inhibit NF-kappa B activation as well as TNF-mediated apoptosis. The encoded protein, which has both ubiquitin ligase and deubiquitinase activities, is involved in the cytokine-mediated immune and inflammatory responses. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display runting, severe multi-organ inflammation, hypersensitivity to lipopolysaccharide and TNF, and premature death. Older mice homozygous for point mutations that disrupt deubiquitinating activity develop splenomegaly and show an increased number of myeloid cells. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	C	T	13: 81,419,230	G5275S	probably benign	Het
Akap11	A	G	14: 78,510,259	S1563P	probably damaging	Het
Ankrd50	A	G	3: 38,457,531	V229A	probably damaging	Het
AW112010	A	G	19: 11,050,393		noncoding transcript	Het
Ccdc158	A	G	5: 92,633,328	S873P	probably benign	Het
Cep350	A	G	1: 155,926,468	V1104A	probably benign	Het
Chil4	G	A	3: 106,214,362	A57V	probably damaging	Het
Cpa5	A	G	6: 30,624,626	E155G	probably damaging	Het
Ctsq	T	C	13: 61,038,912	I93V	probably benign	Het
Dbi	A	T	1: 120,120,805	I37K	probably benign	Het
Defa35	T	C	8: 21,065,192	S43P	probably damaging	Het
Fance	T	A	17: 28,315,807		probably benign	Het
Fbxl6	A	G	15: 76,537,929	L180P	probably damaging	Het
Fkbpl	T	C	17: 34,646,295	F346L	probably damaging	Het
Gm11735	C	A	11: 116,741,275		noncoding transcript	Het
Gm28042	T	C	2: 120,035,840	I373T	possibly damaging	Het
Golga4	T	C	9: 118,514,186	S27P	probably damaging	Het
Gstm1	C	T	3: 108,016,518		probably null	Het
Lama3	T	A	18: 12,549,253	I1092K	probably benign	Het
Med15	A	T	16: 17,671,564		probably benign	Het
Nlrp6	A	G	7: 140,921,781	D87G	probably damaging	Het
Parp11	A	G	6: 127,471,605	T62A	probably benign	Het
Pcnt	A	G	10: 76,401,483	L1323S	probably damaging	Het
Ppp2r1a	C	T	17: 20,955,810	T98I	probably benign	Het
Pramef6	T	A	4: 143,895,840	Y315F	probably damaging	Het
Prl7a2	T	A	13: 27,660,947	H152L	possibly damaging	Het
Rnf145	T	C	11: 44,564,277	S662P	probably benign	Het
Rpl31-ps17	C	T	12: 54,701,612		noncoding transcript	Het
Txlnb	T	TTA	10: 17,838,997		probably null	Het
Usp9x	A	G	X: 13,121,448	D638G	possibly damaging	Het
Vmn1r30	A	T	6: 58,435,133	V238E	probably damaging	Het
Zfp507	A	G	7: 35,787,716		probably null	Het
Zfp532	G	T	18: 65,656,565	W1025L	probably benign	Het

Other mutations in Tnfaip3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
lasvegas	APN	10	19010758	unclassified	probably benign
IGL00840:Tnfaip3	APN	10	19005126	missense	probably damaging	1.00
IGL00966:Tnfaip3	APN	10	19005137	missense	probably damaging	1.00
IGL01080:Tnfaip3	APN	10	19011655	missense	probably benign	0.03
IGL01736:Tnfaip3	APN	10	19006901	missense	probably damaging	1.00
IGL02318:Tnfaip3	APN	10	19004467	missense	probably benign	0.04
IGL02703:Tnfaip3	APN	10	19007032	missense	probably damaging	0.98
IGL03032:Tnfaip3	APN	10	19004609	missense	probably benign
IGL03331:Tnfaip3	APN	10	19011601	missense	possibly damaging	0.63
IGL03389:Tnfaip3	APN	10	19004987	missense	probably benign	0.03
PIT4243001:Tnfaip3	UTSW	10	19011574	missense	probably damaging	1.00
PIT4480001:Tnfaip3	UTSW	10	19007323	missense	probably benign
R0044:Tnfaip3	UTSW	10	19011626	missense	probably damaging	0.98
R0044:Tnfaip3	UTSW	10	19011626	missense	probably damaging	0.98
R0056:Tnfaip3	UTSW	10	19005293	missense	probably damaging	1.00
R0195:Tnfaip3	UTSW	10	19005713	missense	probably damaging	1.00
R0226:Tnfaip3	UTSW	10	19002747	missense	probably damaging	1.00
R0369:Tnfaip3	UTSW	10	19006912	nonsense	probably null
R0744:Tnfaip3	UTSW	10	19002949	missense	probably benign	0.09
R0833:Tnfaip3	UTSW	10	19002949	missense	probably benign	0.09
R1469:Tnfaip3	UTSW	10	19008269	missense	probably damaging	1.00
R1469:Tnfaip3	UTSW	10	19008269	missense	probably damaging	1.00
R1876:Tnfaip3	UTSW	10	19004934	missense	possibly damaging	0.81
R1902:Tnfaip3	UTSW	10	19008189	missense	probably benign	0.19
R1903:Tnfaip3	UTSW	10	19008189	missense	probably benign	0.19
R1922:Tnfaip3	UTSW	10	19003607	missense	possibly damaging	0.51
R1973:Tnfaip3	UTSW	10	19004504	missense	probably damaging	0.98
R2040:Tnfaip3	UTSW	10	19008152	missense	possibly damaging	0.89
R2513:Tnfaip3	UTSW	10	19005659	missense	probably benign	0.00
R2936:Tnfaip3	UTSW	10	19011609	missense	probably damaging	1.00
R3607:Tnfaip3	UTSW	10	19005602	missense	probably damaging	1.00
R4386:Tnfaip3	UTSW	10	19007010	missense	probably damaging	1.00
R4673:Tnfaip3	UTSW	10	19011832	intron	probably benign
R4879:Tnfaip3	UTSW	10	19005573	missense	probably benign	0.03
R5082:Tnfaip3	UTSW	10	19005284	missense	probably damaging	1.00
R5524:Tnfaip3	UTSW	10	19008195	missense	probably damaging	0.98
R6559:Tnfaip3	UTSW	10	19007248	missense	probably damaging	1.00
R6776:Tnfaip3	UTSW	10	19005576	missense	probably benign	0.02
R6853:Tnfaip3	UTSW	10	19003751	missense	probably benign
R6891:Tnfaip3	UTSW	10	19011669	missense	probably damaging	1.00
R7144:Tnfaip3	UTSW	10	19007281	missense	probably benign	0.00
R7693:Tnfaip3	UTSW	10	19004780	missense	probably benign
R8155:Tnfaip3	UTSW	10	19004691	missense	possibly damaging	0.78
R8377:Tnfaip3	UTSW	10	19011510	missense	probably damaging	1.00
R8552:Tnfaip3	UTSW	10	19004465	missense	probably damaging	0.98
R8552:Tnfaip3	UTSW	10	19004666	missense	probably damaging	1.00
R8827:Tnfaip3	UTSW	10	19005047	missense	probably damaging	0.99
R9391:Tnfaip3	UTSW	10	19007327	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCTGGTTAATACGAGGGTACTGG -3'
(R):5'- TGTTAAAGGCAGCCTAACGG -3'

Sequencing Primer
(F):5'- GAGGAAAAGAGCAAGCCTTACCATTG -3'
(R):5'- CAGCCTAACGGAATGGGCTTTAC -3'

Posted On

2015-07-21