Incidental Mutation 'R0099:Zfp93'
ID 33150
Institutional Source Beutler Lab
Gene Symbol Zfp93
Ensembl Gene ENSMUSG00000055305
Gene Name zinc finger protein 93
Synonyms
MMRRC Submission 038385-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock # R0099 (G1)
Quality Score 197
Status Validated (trace)
Chromosome 7
Chromosomal Location 24270420-24277794 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 24275475 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 295 (R295L)
Ref Sequence ENSEMBL: ENSMUSP00000104077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032696] [ENSMUST00000108438]
AlphaFold Q61116
Predicted Effect probably benign
Transcript: ENSMUST00000032696
AA Change: R295L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000032696
Gene: ENSMUSG00000055305
AA Change: R295L

DomainStartEndE-ValueType
KRAB 8 74 8.06e-19 SMART
ZnF_C2H2 285 307 2.71e-2 SMART
ZnF_C2H2 313 335 1.69e-3 SMART
ZnF_C2H2 341 363 8.02e-5 SMART
ZnF_C2H2 369 391 2.36e-2 SMART
ZnF_C2H2 397 419 1.2e-3 SMART
ZnF_C2H2 425 447 2.84e-5 SMART
ZnF_C2H2 453 475 7.78e-3 SMART
ZnF_C2H2 481 503 1.12e-3 SMART
ZnF_C2H2 509 531 2.57e-3 SMART
ZnF_C2H2 537 559 9.73e-4 SMART
ZnF_C2H2 565 587 4.94e-5 SMART
ZnF_C2H2 593 615 9.73e-4 SMART
ZnF_C2H2 621 643 5.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108438
AA Change: R295L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000104077
Gene: ENSMUSG00000055305
AA Change: R295L

DomainStartEndE-ValueType
KRAB 8 74 8.06e-19 SMART
ZnF_C2H2 285 307 2.71e-2 SMART
ZnF_C2H2 313 335 1.69e-3 SMART
ZnF_C2H2 341 363 8.02e-5 SMART
ZnF_C2H2 369 391 2.36e-2 SMART
ZnF_C2H2 397 419 1.2e-3 SMART
ZnF_C2H2 425 447 2.84e-5 SMART
ZnF_C2H2 453 475 7.78e-3 SMART
ZnF_C2H2 481 503 1.12e-3 SMART
ZnF_C2H2 509 531 2.57e-3 SMART
ZnF_C2H2 537 559 9.73e-4 SMART
ZnF_C2H2 565 587 4.94e-5 SMART
ZnF_C2H2 593 615 9.73e-4 SMART
ZnF_C2H2 621 643 5.5e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155851
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930018M24Rik C T 14: 50,896,722 probably benign Het
Acad10 A C 5: 121,621,290 D1043E probably damaging Het
Adamtsl4 C T 3: 95,684,139 G173R probably benign Het
Astn1 G T 1: 158,502,151 S192I probably damaging Het
Atg2a T A 19: 6,252,789 V1010E probably damaging Het
C130079G13Rik A C 3: 59,936,435 K183N probably benign Het
Col11a2 A G 17: 34,049,674 E311G probably damaging Het
Col4a3 A C 1: 82,717,993 E1638A probably benign Het
Cstf2t A G 19: 31,083,831 R256G probably benign Het
Cyp4a12a T C 4: 115,326,672 L225P probably damaging Het
Diexf A G 1: 193,128,470 L75P probably damaging Het
Dnah5 G A 15: 28,239,934 R479H probably damaging Het
Dsg3 A G 18: 20,540,022 I917V probably benign Het
Fam76a G T 4: 132,910,787 probably benign Het
Fras1 T A 5: 96,614,917 probably null Het
Gli1 A G 10: 127,336,006 V293A probably damaging Het
Gm10782 T A 13: 56,363,143 noncoding transcript Het
Greb1l A G 18: 10,509,158 E490G probably damaging Het
Hydin G A 8: 110,589,561 G4362R probably damaging Het
Ica1 A T 6: 8,749,778 probably benign Het
Ikzf4 T A 10: 128,634,197 I485F probably damaging Het
Irf5 A G 6: 29,533,967 T34A probably damaging Het
Krt81 A T 15: 101,463,521 C59* probably null Het
Kynu T A 2: 43,629,053 probably null Het
Ly6g6c T C 17: 35,068,915 V61A probably damaging Het
Manea A C 4: 26,328,104 I312M probably damaging Het
Micall1 G T 15: 79,131,901 probably benign Het
Mthfs A T 9: 89,226,163 probably benign Het
Myh4 A G 11: 67,259,347 T1877A probably benign Het
Myo3a T C 2: 22,245,598 I92T probably benign Het
Nepn A G 10: 52,401,085 S306G probably damaging Het
Nol8 T C 13: 49,672,689 V995A probably benign Het
Olfr1453 A G 19: 13,027,801 F176S probably damaging Het
Olfr1458 T A 19: 13,103,140 T49S probably benign Het
Olfr160 A T 9: 37,711,454 V275E probably damaging Het
Olfr967 A G 9: 39,750,661 I92V possibly damaging Het
Pde1a T A 2: 79,868,313 probably null Het
Phf14 A G 6: 11,987,697 probably benign Het
Plekhh2 C T 17: 84,591,672 Q1026* probably null Het
Polr2b T A 5: 77,320,950 probably benign Het
Ppp1r36 G T 12: 76,436,282 probably null Het
Prdm14 A T 1: 13,118,945 C392S probably damaging Het
Rabgap1l A G 1: 160,682,116 S436P possibly damaging Het
Rfc2 A T 5: 134,595,281 probably null Het
Rfx4 A T 10: 84,894,304 M437L probably benign Het
Rgs17 T A 10: 5,842,583 R74S probably benign Het
Rnf139 C A 15: 58,899,415 L430I probably damaging Het
Sgsm1 C A 5: 113,274,360 probably benign Het
Skint6 T A 4: 112,811,501 T1126S possibly damaging Het
Slc15a2 T C 16: 36,753,036 E602G probably damaging Het
Stpg2 T C 3: 139,243,193 probably benign Het
Sycp2l T C 13: 41,129,525 probably benign Het
Tlr11 A T 14: 50,360,818 N87I probably benign Het
Tril A G 6: 53,818,363 F625L probably damaging Het
Ube3c T A 5: 29,607,064 V434E probably damaging Het
Usp34 G A 11: 23,363,111 G533R probably damaging Het
Other mutations in Zfp93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Zfp93 APN 7 24275692 missense probably damaging 1.00
IGL02939:Zfp93 APN 7 24275084 missense possibly damaging 0.86
IGL02956:Zfp93 APN 7 24274975 missense probably benign 0.25
FR4342:Zfp93 UTSW 7 24275586 missense possibly damaging 0.92
FR4737:Zfp93 UTSW 7 24275389 small deletion probably benign
R0376:Zfp93 UTSW 7 24275861 missense probably damaging 1.00
R1466:Zfp93 UTSW 7 24276096 missense probably damaging 0.99
R1466:Zfp93 UTSW 7 24276096 missense probably damaging 0.99
R1511:Zfp93 UTSW 7 24275731 nonsense probably null
R1628:Zfp93 UTSW 7 24274857 missense probably benign 0.00
R4581:Zfp93 UTSW 7 24275668 missense probably damaging 1.00
R4977:Zfp93 UTSW 7 24275411 missense probably benign 0.00
R5162:Zfp93 UTSW 7 24276332 missense probably damaging 1.00
R6031:Zfp93 UTSW 7 24276300 missense probably damaging 1.00
R6031:Zfp93 UTSW 7 24276300 missense probably damaging 1.00
R6284:Zfp93 UTSW 7 24275629 nonsense probably null
R6471:Zfp93 UTSW 7 24273329 missense probably damaging 1.00
R6694:Zfp93 UTSW 7 24275913 missense probably damaging 1.00
R6969:Zfp93 UTSW 7 24275381 nonsense probably null
R7543:Zfp93 UTSW 7 24275108 missense probably benign 0.13
R7623:Zfp93 UTSW 7 24276369 missense probably damaging 1.00
R7763:Zfp93 UTSW 7 24275218 missense possibly damaging 0.56
R7957:Zfp93 UTSW 7 24275574 missense probably damaging 1.00
R8157:Zfp93 UTSW 7 24276460 nonsense probably null
R8194:Zfp93 UTSW 7 24276054 missense probably benign 0.08
R9700:Zfp93 UTSW 7 24275469 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGGAACTTCATCAACAGACCCTCTT -3'
(R):5'- TCTTGCTGAACTGCTTCTGGCAAA -3'

Sequencing Primer
(F):5'- CTTAGGAAAGAAGTCCCCTGTGC -3'
(R):5'- cccttcccacactcttcac -3'
Posted On 2013-05-09