Incidental Mutation 'R4483:Prl7a2'
ID331503
Institutional Source Beutler Lab
Gene Symbol Prl7a2
Ensembl Gene ENSMUSG00000046899
Gene Nameprolactin family 7, subfamily a, member 2
SynonymsPLP-F, Prlpf
MMRRC Submission 041739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R4483 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location27658584-27668036 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27660947 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 152 (H152L)
Ref Sequence ENSEMBL: ENSMUSP00000006660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006660]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006660
AA Change: H152L

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000006660
Gene: ENSMUSG00000046899
AA Change: H152L

DomainStartEndE-ValueType
Pfam:Hormone_1 17 244 6.9e-45 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,419,230 G5275S probably benign Het
Akap11 A G 14: 78,510,259 S1563P probably damaging Het
Ankrd50 A G 3: 38,457,531 V229A probably damaging Het
AW112010 A G 19: 11,050,393 noncoding transcript Het
Ccdc158 A G 5: 92,633,328 S873P probably benign Het
Cep350 A G 1: 155,926,468 V1104A probably benign Het
Chil4 G A 3: 106,214,362 A57V probably damaging Het
Cpa5 A G 6: 30,624,626 E155G probably damaging Het
Ctsq T C 13: 61,038,912 I93V probably benign Het
Dbi A T 1: 120,120,805 I37K probably benign Het
Defa35 T C 8: 21,065,192 S43P probably damaging Het
Fance T A 17: 28,315,807 probably benign Het
Fbxl6 A G 15: 76,537,929 L180P probably damaging Het
Fkbpl T C 17: 34,646,295 F346L probably damaging Het
Gm11735 C A 11: 116,741,275 noncoding transcript Het
Gm28042 T C 2: 120,035,840 I373T possibly damaging Het
Golga4 T C 9: 118,514,186 S27P probably damaging Het
Gstm1 C T 3: 108,016,518 probably null Het
Lama3 T A 18: 12,549,253 I1092K probably benign Het
Med15 A T 16: 17,671,564 probably benign Het
Nlrp6 A G 7: 140,921,781 D87G probably damaging Het
Parp11 A G 6: 127,471,605 T62A probably benign Het
Pcnt A G 10: 76,401,483 L1323S probably damaging Het
Ppp2r1a C T 17: 20,955,810 T98I probably benign Het
Pramef6 T A 4: 143,895,840 Y315F probably damaging Het
Rnf145 T C 11: 44,564,277 S662P probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Tnfaip3 A T 10: 19,011,627 M50K probably damaging Het
Txlnb T TTA 10: 17,838,997 probably null Het
Usp9x A G X: 13,121,448 D638G possibly damaging Het
Vmn1r30 A T 6: 58,435,133 V238E probably damaging Het
Zfp507 A G 7: 35,787,716 probably null Het
Zfp532 G T 18: 65,656,565 W1025L probably benign Het
Other mutations in Prl7a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Prl7a2 APN 13 27659208 missense probably damaging 0.98
IGL02424:Prl7a2 APN 13 27667970 missense probably null 0.08
IGL02734:Prl7a2 APN 13 27659207 missense probably benign 0.38
IGL02823:Prl7a2 APN 13 27662751 missense possibly damaging 0.95
PIT4260001:Prl7a2 UTSW 13 27659276 nonsense probably null
R0733:Prl7a2 UTSW 13 27662688 missense probably damaging 1.00
R1371:Prl7a2 UTSW 13 27662767 missense probably benign 0.01
R1778:Prl7a2 UTSW 13 27659271 missense probably damaging 0.98
R1857:Prl7a2 UTSW 13 27659180 nonsense probably null
R2063:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2064:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2065:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2067:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2068:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2176:Prl7a2 UTSW 13 27659106 missense probably benign 0.10
R2213:Prl7a2 UTSW 13 27665068 missense probably benign 0.06
R4111:Prl7a2 UTSW 13 27665067 missense possibly damaging 0.96
R4459:Prl7a2 UTSW 13 27665996 missense probably benign 0.21
R4722:Prl7a2 UTSW 13 27660875 missense probably damaging 1.00
R5360:Prl7a2 UTSW 13 27659160 missense probably benign 0.22
R5778:Prl7a2 UTSW 13 27661000 nonsense probably null
R6667:Prl7a2 UTSW 13 27661041 missense probably benign 0.03
R7107:Prl7a2 UTSW 13 27659093 missense possibly damaging 0.89
R7600:Prl7a2 UTSW 13 27659281 missense possibly damaging 0.63
R8298:Prl7a2 UTSW 13 27661011 missense probably benign 0.00
R8447:Prl7a2 UTSW 13 27665958 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CTGAGAATATCTACAAGTGAGATGC -3'
(R):5'- AGCAAATTCTTGGGCTCCC -3'

Sequencing Primer
(F):5'- GCTTCAAATTTTAATCTCTGTTGCAG -3'
(R):5'- GGGCTTGGAATGAAACTTC -3'
Posted On2015-07-21